ID: 1054281213

View in Genome Browser
Species Human (GRCh38)
Location 9:63130105-63130127
Sequence ACACTCAACATGTCCAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054281201_1054281213 27 Left 1054281201 9:63130055-63130077 CCAGCTGCCTCCTCACTGGCCAT 0: 9
1: 0
2: 3
3: 46
4: 474
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281204_1054281213 8 Left 1054281204 9:63130074-63130096 CCATCCCACCCAAGTGTCTAGCG No data
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281202_1054281213 20 Left 1054281202 9:63130062-63130084 CCTCCTCACTGGCCATCCCACCC 0: 9
1: 0
2: 3
3: 54
4: 555
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281207_1054281213 4 Left 1054281207 9:63130078-63130100 CCCACCCAAGTGTCTAGCGGGCT No data
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281208_1054281213 3 Left 1054281208 9:63130079-63130101 CCACCCAAGTGTCTAGCGGGCTC No data
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281203_1054281213 17 Left 1054281203 9:63130065-63130087 CCTCACTGGCCATCCCACCCAAG 0: 9
1: 0
2: 3
3: 28
4: 266
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281210_1054281213 -1 Left 1054281210 9:63130083-63130105 CCAAGTGTCTAGCGGGCTCCTCA No data
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data
1054281209_1054281213 0 Left 1054281209 9:63130082-63130104 CCCAAGTGTCTAGCGGGCTCCTC No data
Right 1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054281213 Original CRISPR ACACTCAACATGTCCAGAAA GGG Intergenic
No off target data available for this crispr