ID: 1054282521

View in Genome Browser
Species Human (GRCh38)
Location 9:63138377-63138399
Sequence TGGTGGTAAGAGGGACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 7, 1: 2, 2: 0, 3: 25, 4: 302}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282521_1054282536 23 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282521_1054282538 27 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data
1054282521_1054282537 26 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282521_1054282535 22 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282521_1054282539 28 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282521_1054282532 17 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282532 9:63138417-63138439 TCTATCCACATATCACCCCTTGG No data
1054282521_1054282533 21 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282521 Original CRISPR TGGTGGTAAGAGGGACAAGA GGG (reversed) Intergenic
900204828 1:1427391-1427413 TGGAGGGAAGGGGGAGAAGAGGG - Intronic
900637453 1:3672901-3672923 TGGGGGTAAGCGGGTCAGGAGGG - Intronic
901190941 1:7409386-7409408 TGGTGGCCAGAGGGGCAGGATGG - Intronic
901197801 1:7449954-7449976 TGGGGGTAGGAGGGAGGAGAGGG + Intronic
902108235 1:14055978-14056000 TGGTGATAAGAGGGGGTAGAGGG - Intergenic
902191595 1:14766978-14767000 TGGTGGGGAGTGGGACGAGATGG + Intronic
903856409 1:26340035-26340057 TGGTGGGAGGATGGGCAAGATGG + Intronic
904725408 1:32543468-32543490 TGGAGTTAAGAGGGTCATGATGG - Intronic
905860746 1:41349590-41349612 TGGTGTTAAGATGGGCATGAGGG - Intergenic
905910107 1:41647782-41647804 TGGTGGCAAGAGATCCAAGAAGG - Intronic
906191965 1:43904730-43904752 TGGTGGGAAGAGGAGCAGGAGGG - Intronic
906192028 1:43904963-43904985 TGGTGGGAAGAGGAGCAGGAAGG - Intronic
906206188 1:43987941-43987963 GAGTGCTAAGAGAGACAAGAGGG - Intronic
906668922 1:47640861-47640883 TGGTGATTAGAGGGACATGCAGG + Intergenic
907749712 1:57250988-57251010 TGGTGGTATGAGGGACATGGAGG + Intronic
907964424 1:59315431-59315453 TGGTGGGGAGAGGGAAAAAAGGG - Intronic
908098203 1:60762823-60762845 TGGTGGGAAGAGGGAGGAAAGGG + Intergenic
908164961 1:61448838-61448860 TGGTGGTAAGAGAGACACTAGGG + Intronic
908580580 1:65512061-65512083 TGGTGGGAGCAGGAACAAGAGGG + Intronic
908657681 1:66405259-66405281 TGGTGGCAGCAGGAACAAGAAGG - Intergenic
908955599 1:69622662-69622684 TGGTGGTTAGAAGAACAATAAGG + Intronic
910545495 1:88411717-88411739 TGGTAGTAAGAGTGAGGAGACGG - Intergenic
910974032 1:92886917-92886939 TGGTTGTAACAGAGACAATATGG + Intronic
911239612 1:95450732-95450754 TGAGGGTAAGAGGGAGTAGAGGG + Intergenic
911660824 1:100499477-100499499 TGGGGGTAAGAAGAAAAAGAAGG - Intronic
912223594 1:107705442-107705464 TGAGGGTAGGAGGGAGAAGAGGG + Intronic
913041834 1:115034445-115034467 TGGTGGTAAAATGGAGAACAGGG + Intergenic
913061536 1:115212895-115212917 TCTTGGTAAGAGAGAGAAGAAGG - Intergenic
915469199 1:156115515-156115537 TGGGGGTATCAGGGACAAGTTGG + Intronic
917655531 1:177121963-177121985 TTGTGCTAAGTGGGTCAAGAGGG - Intronic
918623868 1:186635976-186635998 TGCTTTGAAGAGGGACAAGAGGG + Intergenic
920116600 1:203626210-203626232 TGGTGGGTACAGGGACAAGAGGG + Intergenic
921061636 1:211590202-211590224 AGGAGGTAAAAGGGATAAGAAGG - Intergenic
921325250 1:213982467-213982489 TTCTGGTAAGATGGACAATATGG + Intergenic
921705546 1:218318838-218318860 TGATGGTAAAAGGCAAAAGATGG - Intronic
922054866 1:222032116-222032138 AGGAGGTAAGTGGGAGAAGAAGG - Intergenic
922630155 1:227098691-227098713 TAGTGGCAAAAGGGATAAGAAGG - Intronic
923972169 1:239216828-239216850 TGTGGGTAAGGGGGAGAAGATGG + Intergenic
1065722782 10:28642675-28642697 TGGAGGTAAGAAGCCCAAGAAGG - Intergenic
1068325282 10:55477229-55477251 TGGTTGTAAAAGAGACATGAAGG + Intronic
1070528921 10:77319242-77319264 GGGTGGGATGAGGGACAAGAGGG - Intronic
1070637489 10:78140872-78140894 GGGCGGGAAGAGGAACAAGAGGG - Intergenic
1072040741 10:91603800-91603822 TGGTGTTAGGAGGGCCCAGAAGG - Intergenic
1073054792 10:100692385-100692407 TTGTGGTAAGTGGGAACAGAGGG - Intergenic
1073435908 10:103515807-103515829 TGGAGTTAAGAGGGACAAGTTGG + Intronic
1074507769 10:114086646-114086668 TGGTGGTGGGAGGGAAGAGAAGG + Intergenic
1078766419 11:14302757-14302779 TGGTGGGACTAGGGACAGGATGG - Intronic
1079144844 11:17841470-17841492 TGGAGATAAGAAGGACAACATGG - Intronic
1079145126 11:17844446-17844468 AGGTGGTCAGAGGTACGAGAGGG - Intronic
1079236396 11:18693723-18693745 TGGTGGAAAAAAGGAAAAGAAGG - Intronic
1080146481 11:28991152-28991174 GGGTGGTAGGAGGGAGAAGATGG - Intergenic
1080483251 11:32675033-32675055 TGGGGGTAAGAGGGTGAAGGAGG - Intronic
1080590212 11:33716808-33716830 AGGAGGTAAGAGGGCTAAGAAGG - Intronic
1081118030 11:39229364-39229386 TGGTGGTAAAAGAGTAAAGAGGG + Intergenic
1081289597 11:41308143-41308165 TTGGTGAAAGAGGGACAAGATGG - Intronic
1081503151 11:43687175-43687197 TTTTGCTAAGAGTGACAAGAAGG - Intronic
1081592407 11:44433682-44433704 TGGTGCCAAGTGGGAGAAGATGG + Intergenic
1085171363 11:74452546-74452568 GGCAGGGAAGAGGGACAAGAGGG - Intergenic
1087591589 11:100196001-100196023 TGGGAGTCAGAGGGACAGGATGG + Intronic
1089515000 11:119026705-119026727 TGGTGGGAAGAGGGAAGGGAAGG + Intronic
1089620732 11:119720801-119720823 TGGTGGGAAGAACCACAAGATGG + Intronic
1089902415 11:122001199-122001221 TGTTGGAAAGAGGAACTAGAGGG - Intergenic
1091351106 11:134895255-134895277 GGGTGGGATGAGGGAGAAGAGGG - Intergenic
1092744309 12:11659369-11659391 TGGTGGTAGGAGGGACAGGTGGG - Intronic
1092793032 12:12085815-12085837 TGGAGGTAAGAGAGGCAAGTAGG - Intronic
1092933366 12:13338046-13338068 GGGTGGTAAGAGGATCAAGGCGG + Intergenic
1092975974 12:13745296-13745318 TGGTGGGAAGAGAGAGCAGATGG + Intronic
1093449119 12:19295734-19295756 TGGTTGTAAGATAGAGAAGAAGG + Intronic
1093494761 12:19743330-19743352 TGAGGGTAAGAGGCACATGAGGG + Intergenic
1094837744 12:34330084-34330106 AAGTGGCAAGAGGGCCAAGAAGG - Intergenic
1096489309 12:52005114-52005136 AGGTGGGAGGAGGGAGAAGAAGG + Intergenic
1096591520 12:52663067-52663089 GGGTGGTTACAGGGGCAAGATGG + Intergenic
1096839896 12:54373787-54373809 TGGGGGTAAGGGTGACAGGATGG + Intronic
1097170446 12:57110008-57110030 TGGAGGAAAGAGGGGCATGAAGG - Intronic
1099995113 12:89769886-89769908 TGGTTGTAAGAGGGGCCAGATGG + Intergenic
1101093637 12:101313719-101313741 TGGTGGGGAGTGGGACAGGAAGG + Intronic
1102213844 12:111146337-111146359 TGGGGGAAAGAGGGATAAGTAGG - Intronic
1102534884 12:113574183-113574205 TGGTGATCAGAGGGGCAGGAGGG + Intergenic
1103131613 12:118473724-118473746 TGGTAGTAGGAGAGTCAAGATGG + Intergenic
1103871793 12:124097550-124097572 TGGTGGCAACAGGAAAAAGATGG - Intronic
1104498708 12:129264910-129264932 TGGGGGTAAGAGTGAGAAGGGGG + Intronic
1104623265 12:130334078-130334100 TGGGGGTGACAGGGACTAGATGG - Intergenic
1106742413 13:32660105-32660127 GGGTGGGAAGAGGAGCAAGATGG - Intronic
1107414743 13:40190153-40190175 TGGGGGTCATAGGGACAAAAGGG + Intergenic
1109082836 13:57928665-57928687 TGTTGGTATGAGGGATTAGAGGG - Intergenic
1112685038 13:101815155-101815177 TGGTGGAAAGAAAGAAAAGATGG + Intronic
1115095900 14:29635320-29635342 TTGTGGGAAGGGGGACAAGGAGG - Intronic
1115887900 14:37994215-37994237 TGCTTGGAAGAGGGACAAGTGGG - Intronic
1116163992 14:41310621-41310643 TGGTGGCAAGAGGAAAAATAAGG - Intergenic
1117285915 14:54285681-54285703 TGGTGGTAGGGGAGAAAAGAAGG + Intergenic
1118515194 14:66520840-66520862 GGGTGGGAAGAGGGATAAGCAGG - Intronic
1119791740 14:77356516-77356538 TGTTGGTGAGTGGGGCAAGAAGG - Intronic
1120211067 14:81634331-81634353 TAGTGGTAAGAGGAACAATTAGG + Intergenic
1121687151 14:95844915-95844937 GGGTGGAAGGAGGGACAAGAGGG - Intergenic
1202845043 14_GL000009v2_random:162723-162745 TGGTAGTAAGAGGGAATATATGG - Intergenic
1124558682 15:30750566-30750588 TGGTGGTGTGGGGGACAAGGAGG - Intronic
1125443612 15:39729895-39729917 GGGTGGTAGGAGGGAGAGGATGG + Intronic
1126522692 15:49614786-49614808 TGGTGGTAAGAAGGAGGAGTTGG - Intronic
1126675824 15:51158706-51158728 GGGGGAAAAGAGGGACAAGAGGG - Intergenic
1126998360 15:54472996-54473018 TGGGGGAGAGAGGGAAAAGAGGG - Intronic
1127040669 15:54973161-54973183 TGGTGATAGGAGAGAGAAGAAGG + Intergenic
1127726986 15:61759954-61759976 TGATGGTAAGAGAGACAACTTGG - Intergenic
1128044015 15:64601094-64601116 TGGTGGCATCAGGAACAAGAGGG - Intronic
1130658783 15:85813490-85813512 TGGTGGAAAGAGTGGGAAGAGGG - Intergenic
1130841238 15:87703205-87703227 TGTTGGTAAGATGGCCAAGATGG - Intergenic
1131339016 15:91578903-91578925 TGGTCATAGTAGGGACAAGAAGG - Intergenic
1132838078 16:1964627-1964649 TGCTGGGAAAAGCGACAAGAAGG + Exonic
1133398583 16:5468072-5468094 GGGTGGGAGGAGGAACAAGAGGG - Intergenic
1136036761 16:27546368-27546390 CGGTAGTAAGAGGGGAAAGAAGG - Intronic
1139369510 16:66458100-66458122 TGCTGGTTAGAGGGAGAAGGGGG - Intronic
1139450390 16:67024563-67024585 TGGTGGGAAGAGGGCCAAGCTGG - Intergenic
1139955859 16:70692680-70692702 TGGTGGTCACAGTGACAAAAGGG + Intronic
1140115268 16:72036287-72036309 TGGTGGTGAGATGGAAAAAATGG + Intergenic
1140527661 16:75637014-75637036 TGTTGGTTTGAGGGAAAAGATGG - Intronic
1140903525 16:79391841-79391863 TGGGGGAAAGAGAGAGAAGAAGG + Intergenic
1141888938 16:86913605-86913627 TGTTGGGAAGAGGTGCAAGAGGG - Intergenic
1142262414 16:89049181-89049203 TGAGGGCAAGAAGGACAAGACGG - Intergenic
1143272041 17:5683056-5683078 TGCTGGCCAGAGGGACAGGAGGG - Intergenic
1143545261 17:7591623-7591645 TGGGGGTAGGGTGGACAAGAGGG + Exonic
1143724677 17:8836963-8836985 TGGAGGTAAGAGGGAGGAGGGGG + Intronic
1144664406 17:17092113-17092135 TGGTGGAAGAAGCGACAAGATGG - Intronic
1144788957 17:17847035-17847057 TGATGGAGAGAGGGTCAAGAAGG + Exonic
1146270506 17:31482174-31482196 TGGTGGGAAGAGGCAGAGGAAGG + Intronic
1148066681 17:44876122-44876144 AGGTGGTAAGAAGAACAAGGAGG + Intronic
1148235528 17:45965986-45966008 TGGTGGAAAGAGTGACAAGGGGG - Intronic
1148401609 17:47367381-47367403 TGGCGGCAAGAGGGGCAGGATGG + Intronic
1150121907 17:62610718-62610740 AGGTGGTAAGAGAGGCAGGAGGG + Intronic
1151809233 17:76427136-76427158 TGGTGGTATGAGGGCCCAGTGGG - Intronic
1152167342 17:78718434-78718456 TGGAGGTTGGAGGAACAAGATGG - Intronic
1154159246 18:11968335-11968357 TGGTGGTTAGGGAAACAAGAAGG - Intergenic
1154390003 18:13928368-13928390 TGGTATTAAGAGGAAAAAGATGG + Intergenic
1155050902 18:22146880-22146902 TGGTGGCAAAAGGAACACGATGG - Intergenic
1155895728 18:31323664-31323686 TGGTGATAAAAGGGAACAGAGGG - Intronic
1157186050 18:45540819-45540841 AGGTGGCAAGAGGGAAAAGAAGG - Intronic
1159519246 18:69496370-69496392 TGGTGGTAGCCGGGACAAGTGGG - Intronic
1160019971 18:75172811-75172833 TTGTGTTAAGAGGGAGAAGACGG + Intergenic
1160688511 19:448850-448872 AGGTGGTAAAAGAGACAGGACGG + Intronic
1160765810 19:807154-807176 TCGTGGTAAGAGGCACAGGCAGG - Intronic
1162585532 19:11555932-11555954 TAGTGGCTAGAGGGACAAGGTGG + Intronic
1162805508 19:13136162-13136184 TGGTGGGATGGGGGACAGGACGG - Intronic
1163523862 19:17808413-17808435 GGGTGGTAATTTGGACAAGAAGG - Intronic
1163949829 19:20573004-20573026 TGGTGGTGGCAGGGCCAAGATGG - Intronic
1164766567 19:30777075-30777097 GGATGGGAAGAGGGGCAAGAGGG + Intergenic
1165847967 19:38831214-38831236 TTGTGGGAAGATGGACATGAGGG - Intronic
1167043968 19:47039368-47039390 TGGTTGGAGGAGGGACAAGGCGG - Intronic
1168439438 19:56351301-56351323 AGGTGGTAACAAGGAGAAGACGG - Intronic
925874622 2:8301340-8301362 TGGTGGAGAGAGGGACCAAATGG - Intergenic
927683332 2:25154497-25154519 AGGAGGTAGGAGGGCCAAGAAGG - Exonic
928265376 2:29806862-29806884 TGGTGGTAAGAGGAACAAACAGG + Intronic
931847815 2:66222559-66222581 TGGTGATCAGAGCGCCAAGAAGG + Intergenic
931996215 2:67841755-67841777 TGGTGGTAAGTTTGCCAAGAAGG - Intergenic
932816632 2:74867019-74867041 TGGGGGTATGAGGAACAGGATGG + Intronic
933036760 2:77409879-77409901 TGATGTTAAGTGGGGCAAGAAGG - Intronic
933253027 2:80050012-80050034 TGGTGGGAAGAGGAAGGAGAGGG - Intronic
934476872 2:94599523-94599545 TGGTGGCAAGAGGGACAAGAGGG - Intronic
936445832 2:112594422-112594444 TGGTGGTGAGAATGACAAGCTGG - Intergenic
936876947 2:117201421-117201443 TGGAGGTGAGAGTGACAACAGGG - Intergenic
939807816 2:146795087-146795109 TGGTGGTAAGAAAGAAAAAAAGG - Intergenic
940068572 2:149657449-149657471 TGGTGTGAAGAGGGAAAAAAGGG - Intergenic
941885319 2:170521754-170521776 TGGTGGTAAAAGCAAAAAGAAGG - Intronic
942392517 2:175510475-175510497 TGGGGAGAAGAGGGAAAAGAAGG - Intergenic
942545337 2:177057474-177057496 TGATGGTGGGATGGACAAGAGGG + Intergenic
942702203 2:178725386-178725408 TGGTGGAATGAGGGAGAACATGG - Exonic
943315597 2:186383960-186383982 TAGTGCTAAGTGGGACCAGAAGG - Intergenic
944834995 2:203570472-203570494 GGGTGGTAACAGGGGAAAGAGGG - Intergenic
946441047 2:219696325-219696347 TGGTGAGAAGAGGGAGGAGACGG - Intergenic
946629805 2:221654881-221654903 TGGTGGGAAGAGGGAAAGAAAGG - Intergenic
947165587 2:227258290-227258312 TGGTGGCAAAAGGGTCATGAGGG + Intronic
947312488 2:228819266-228819288 TGGAGGTAAGCAGAACAAGACGG - Intergenic
947366754 2:229404178-229404200 TGGAGGTAAGAGGGAAAAAGAGG + Intronic
948171900 2:235910512-235910534 GGGTGGGAAGAGAGAAAAGAAGG + Intronic
948396711 2:237650121-237650143 GGGTGGAGAGAGGAACAAGAAGG + Intronic
1168839848 20:903038-903060 TGGGTGTAAGAGGGTCAAGGCGG + Intronic
1171206860 20:23288218-23288240 TGGTGGCAAGAGGGATTTGAGGG - Intergenic
1172669800 20:36627154-36627176 TGGTGGGCAGAGGGTCCAGAGGG + Intronic
1172848482 20:37944378-37944400 TGGTGGAAAGAGGGCCGACATGG - Exonic
1174275351 20:49399666-49399688 TGGTAGCAAGAGAGAAAAGAAGG - Intronic
1174340589 20:49892665-49892687 TGGTGGCATGTGGGGCAAGAAGG + Intergenic
1177125821 21:17192154-17192176 TGGGGGTGATGGGGACAAGAGGG - Intergenic
1178886085 21:36486000-36486022 GGATGGCAAGAAGGACAAGAAGG - Intronic
1178989918 21:37344294-37344316 TGCTGGTAGGAAGGTCAAGAGGG + Intergenic
1179252881 21:39687944-39687966 TGGTGGTGAGGGGGAAAAGGTGG - Intergenic
1179342915 21:40529582-40529604 TGCTGATATGAGGGACATGATGG - Intronic
1179997901 21:44982299-44982321 TGGTGTTAAGAGGGACAGCGGGG + Intergenic
1181830367 22:25555649-25555671 TGCTGGTTACAGGGACAGGAAGG + Intergenic
1182014155 22:27025143-27025165 TGGGTGTAGGAGGGGCAAGAAGG + Intergenic
1182371215 22:29812405-29812427 TGGTGCTAAGAGGGCAAAGTGGG + Intronic
1185415959 22:50710381-50710403 AGGTGGTGAGAGAGAGAAGAGGG + Intergenic
949412658 3:3782743-3782765 TGAAGGGAAGAGAGACAAGAAGG + Intronic
949691851 3:6649933-6649955 TGCTGGTAAGAGAGTCAAGAGGG - Intergenic
950046118 3:9949502-9949524 TGGTGGTCTGAGGGAGAAGTGGG + Exonic
950728025 3:14931519-14931541 TGGTGGTGGGAGGAAGAAGAAGG - Intronic
951437292 3:22679579-22679601 TGCTGAGAAAAGGGACAAGAAGG - Intergenic
952196212 3:31077855-31077877 GGTGGGGAAGAGGGACAAGATGG + Intergenic
953417361 3:42730655-42730677 TGATGGTTGGAGGGACTAGAAGG + Intronic
954224329 3:49172612-49172634 TGGAGGAAAGAGGGAAAACAGGG - Intronic
954291634 3:49653026-49653048 TGGTGAGTAGAGGGACATGAAGG - Exonic
955977245 3:64490494-64490516 TGGGGGGAAGAGAGAGAAGAAGG + Intergenic
957909633 3:86604574-86604596 TTGTGGCAGGAGGGAGAAGAAGG - Intergenic
958130343 3:89411449-89411471 TGGTGGTGAGAGGGCAAATAGGG - Intronic
958860103 3:99436041-99436063 GTGTGGTGAGAGGGACCAGATGG + Intergenic
959137726 3:102445371-102445393 TGGTTGTAAAAGGGACGGGAGGG - Intronic
959866487 3:111276356-111276378 AGGTGGTAAGAAGGAAAAGCAGG - Intergenic
960865385 3:122194441-122194463 TGGTGGGTAGGGGGACAGGAAGG - Intronic
962734052 3:138308359-138308381 TGGTGGTAACTGAGACATGAGGG - Intronic
962842927 3:139251961-139251983 TGCTGGTAAGGGGGAAAACAGGG + Intronic
966753908 3:183350423-183350445 TGGTGTTAAAAAGAACAAGAGGG - Intronic
967070671 3:185959885-185959907 TAGTGGTAACAGGAACAAGGAGG + Intergenic
969196415 4:5567088-5567110 GGCTGGTCAGAGGAACAAGAGGG - Intronic
971086987 4:23290011-23290033 TGTTGGTATGAGGAACAAAAAGG + Intergenic
971154192 4:24064485-24064507 TGGTGGTGACAGGGAGAAGAGGG + Intergenic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
973123472 4:46553628-46553650 TGATTGAAGGAGGGACAAGATGG + Intergenic
973753852 4:54052722-54052744 TGTTGGCAAGAAGGTCAAGATGG + Intronic
974612453 4:64233340-64233362 TGCTTGTAAGAGGGCCAAGTGGG + Intergenic
974745085 4:66062186-66062208 TGGACGTAAAAGGAACAAGAGGG - Intergenic
975167143 4:71189096-71189118 TGGGGGTGACAAGGACAAGATGG + Intronic
975647068 4:76555779-76555801 AGGTGGTAGGAGGGACAGGGTGG - Intronic
976028347 4:80719773-80719795 TGATGGTAGGCTGGACAAGATGG - Intronic
976357747 4:84138887-84138909 TGGTGGTAGGAGCTATAAGAAGG - Intergenic
976597654 4:86909029-86909051 TGGTGGGGAGTGGGACAAGTTGG + Intronic
978471896 4:109077408-109077430 TGGTGGGAAGAGGCAATAGATGG - Intronic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
983344458 4:166509061-166509083 TAGTGGAAAGAGGGAAAACATGG - Intergenic
983550941 4:169016762-169016784 TGGGGATAAGAGGGCAAAGAAGG + Intergenic
983747432 4:171219153-171219175 TGGTGGGAACAAGGACAAGATGG - Intergenic
984223519 4:177006488-177006510 TGTTGGTAATAGGGTCCAGATGG - Intergenic
990355360 5:54961270-54961292 AGGTGCTAAGAGGCACATGAGGG + Intergenic
990694980 5:58406170-58406192 TGAAGTTAAGAGGGACAAAAAGG + Intergenic
992113284 5:73516066-73516088 TGGTAGAAACAGGGACAAGAAGG + Intergenic
992202528 5:74398505-74398527 TGTTGGTGAGAGGAACAAGCTGG + Intergenic
994182711 5:96785017-96785039 TGGTGGTGAGAAGAACCAGAAGG + Intronic
994454654 5:99989377-99989399 TGGTGGTAATAAGGGTAAGAAGG + Intergenic
995819553 5:116213871-116213893 TGTTGTTAAAAGGGACAAAAAGG + Intronic
996598594 5:125233989-125234011 TGGTGGTAGGGGGGTCAACAAGG + Intergenic
997357428 5:133272369-133272391 TGGTGGTAAGGAGGGCATGATGG + Intronic
998413657 5:141929783-141929805 TGGTGGTGAGCTGGGCAAGATGG + Intronic
998451114 5:142235462-142235484 TGTGGGTAAGGGGGAGAAGAGGG + Intergenic
998453041 5:142249560-142249582 TGGTGGTGAGAGGCAAAAAAAGG + Intergenic
1000335640 5:160239332-160239354 GGGTGATAGGAGGGACAGGAGGG + Intergenic
1001600521 5:172925326-172925348 CGGTGGTTACAGAGACAAGAAGG - Intronic
1003812101 6:9795947-9795969 TGGGGGACAGAGAGACAAGACGG - Intronic
1005067086 6:21828899-21828921 TGGTGGGAAGAGTGAACAGACGG + Intergenic
1005425962 6:25702565-25702587 TGGAGGTAAGGGTGACATGAAGG - Intergenic
1005990661 6:30899738-30899760 TGGGGGTGAGGAGGACAAGAAGG + Intronic
1006409244 6:33862846-33862868 TCTTGGGAAGAGGGAAAAGACGG + Intergenic
1007116128 6:39344618-39344640 TGGTGGTAAGAGGATAGAGAAGG - Intronic
1008004551 6:46396776-46396798 TGGTTGTAATAGAGATAAGAAGG - Intronic
1010367015 6:75062740-75062762 TGGAGGTGATGGGGACAAGATGG - Intergenic
1012476021 6:99614836-99614858 TGGTGGGAAGAGGGACCCAATGG + Intronic
1012837887 6:104293520-104293542 TGGTGGTAAGTGGTCCAGGAAGG - Intergenic
1013619061 6:111872110-111872132 TGGGGGAAGGAGGGGCAAGAAGG + Intronic
1014185167 6:118426802-118426824 TGGTGATTACAGGGGCAAGATGG + Intergenic
1014311309 6:119805491-119805513 TAGTGGGAAGAGGAACAAGAGGG - Intergenic
1015014254 6:128391288-128391310 TGGTGGTAATGGGGAGAGGAAGG - Intronic
1015040919 6:128717813-128717835 TGGAGGTATGAGGGCCAAGTAGG - Intergenic
1015567600 6:134589873-134589895 TGCAGGAAAGAGGGAGAAGATGG - Intergenic
1015860003 6:137665833-137665855 TGGTGGTGAGATGGGGAAGACGG + Intergenic
1015864640 6:137715744-137715766 TGGTGGTAAGAGGGGACAGTTGG - Intergenic
1016344779 6:143101418-143101440 TGGGGGAAAGAGGGATAAGTTGG + Intronic
1016393486 6:143598255-143598277 TCCTTATAAGAGGGACAAGAAGG + Intronic
1017303554 6:152890526-152890548 TGGTTGTAATGGGGAAAAGAGGG - Intergenic
1018528826 6:164742114-164742136 AGGTGGGAAGAGTGAGAAGATGG - Intergenic
1019476084 7:1245023-1245045 ATTTGCTAAGAGGGACAAGATGG - Intergenic
1021894222 7:25219128-25219150 AGGTAGGAAGAGGGAGAAGAAGG - Intergenic
1022129864 7:27395269-27395291 GGGTGGAAAGAAGGACAGGAGGG - Intergenic
1022482477 7:30752975-30752997 TGGTGGTCTGTGGGATAAGAGGG + Intronic
1022836980 7:34127492-34127514 TGGTGGGATCAGGGAGAAGAGGG - Intronic
1023569966 7:41561624-41561646 TGGTGGGAAGAGAGAGAGGAAGG + Intergenic
1024030085 7:45453632-45453654 TGGTGGTAGGAGGCAAGAGAGGG + Intergenic
1024510975 7:50204645-50204667 GTTTGCTAAGAGGGACAAGAGGG + Intergenic
1024904359 7:54359579-54359601 TTGTGGTAATAGGAATAAGATGG + Intergenic
1029814709 7:103081237-103081259 TGGTGGGAAGAGGCACAATGTGG - Intronic
1030192216 7:106821335-106821357 TGGTTGTAGGAGGGGCCAGATGG - Intergenic
1032928505 7:136637891-136637913 TGGTGGGAAGAGGGGAGAGAAGG - Intergenic
1033288826 7:140063963-140063985 TGGTGGTAAACGAGAAAAGATGG + Intergenic
1033733734 7:144202247-144202269 TAGTGGTAAGAGTGGTAAGATGG + Intergenic
1033749316 7:144348726-144348748 TAGTGGTAAGAGTGGTAAGATGG - Intergenic
1033810154 7:145002377-145002399 TGGTGGGAAGATGGACCAGTGGG + Intergenic
1034610402 7:152362306-152362328 GGGGGGTTAGAGGGACAAGAAGG + Intronic
1037316271 8:17602300-17602322 GGCTGGTCAGAGGGACAAGCTGG + Intronic
1037658180 8:20905339-20905361 TTGTGATGAGAGGGAAAAGAGGG + Intergenic
1037764245 8:21762194-21762216 TGGTGGTGAGGGGGCCCAGAAGG - Intronic
1039175389 8:34798547-34798569 TGGTAATAAGAGGGAAAGGAAGG - Intergenic
1039352523 8:36778915-36778937 TGGTGGGAAGAGACACAAGTGGG - Intergenic
1040016614 8:42705490-42705512 AGGGGGTGAGAGAGACAAGAGGG - Intronic
1040308729 8:46225643-46225665 TGGTGAAAACAGGGCCAAGATGG + Intergenic
1040899213 8:52401427-52401449 GGGTTGTTAGAGGGAGAAGAAGG - Intronic
1043846585 8:85170585-85170607 TGGTGGAGAGAGGGAGAACAAGG + Intergenic
1045164346 8:99586611-99586633 TTGTGGGGAGAGGGAAAAGATGG + Intronic
1046713037 8:117534741-117534763 TGGTGGGCACAGGGAAAAGATGG + Intronic
1046806198 8:118481439-118481461 TGGTAGGAAGAAGGAAAAGAGGG + Intronic
1046806398 8:118483802-118483824 TGGGGGTAAGAATGACAATATGG - Intronic
1047275828 8:123404182-123404204 TGATGGGAAGGGTGACAAGATGG - Intronic
1047316557 8:123740040-123740062 TGTTGGAAAGACGGACAGGATGG + Intergenic
1050987340 9:12100305-12100327 TGGTGGAAAGAGGGCCAAGTGGG - Intergenic
1051070411 9:13159404-13159426 TGGTGGGAAGAGCTCCAAGAGGG + Intronic
1051071257 9:13170647-13170669 TGGTGCTAATAAGAACAAGATGG - Intronic
1051969531 9:22871438-22871460 TAGTTGTAAGAGGGAGAATATGG - Intergenic
1052484027 9:29072672-29072694 TGATGATAAGAGGGGGAAGAAGG - Intergenic
1052853155 9:33390383-33390405 TGGTGGTGAGAGGGACAAGAGGG + Intronic
1053385732 9:37686262-37686284 TGGTGGTAGGAGTGGCCAGAGGG + Intronic
1053681193 9:40486557-40486579 TGGTGGTAAGAGGGACAAGAGGG + Intergenic
1053931182 9:43114881-43114903 TGGTGGTAAGAGGGACAAGAGGG + Intergenic
1054282521 9:63138377-63138399 TGGTGGTAAGAGGGACAAGAGGG - Intergenic
1054294280 9:63322072-63322094 TGGTGGTAAGAGGGACAAGAGGG + Intergenic
1054392302 9:64626561-64626583 TGGTGGTAAGAGGGACAAGAGGG + Intergenic
1054426950 9:65131772-65131794 TGGTGGTAAGAGGGACAAGAGGG + Intergenic
1054503425 9:65889768-65889790 TGGTGGTAAGAGGGACAAGAGGG - Intronic
1055734691 9:79314354-79314376 TGGGGGAATTAGGGACAAGATGG - Intergenic
1055988273 9:82076769-82076791 AGGAGCTTAGAGGGACAAGAAGG - Intergenic
1057570724 9:96202386-96202408 TGGGGGTGAGGAGGACAAGAGGG + Intergenic
1057940373 9:99276783-99276805 TGGTGGTGAAGGGGAAAAGAAGG + Intergenic
1058608094 9:106744903-106744925 TGGTGGAGAGAGGGACATGCTGG + Intergenic
1058983355 9:110190279-110190301 TGTTGGTAGGAGGAACAAAAAGG + Intronic
1059218655 9:112591001-112591023 TGGTGGTGATAAGGAAAAGAAGG + Intronic
1059251688 9:112891861-112891883 TTGTGGGTAGAGGGACAGGAAGG - Intergenic
1059424276 9:114210996-114211018 TCCTGGCAAGAGGGGCAAGATGG + Exonic
1059548089 9:115199236-115199258 TGGTGGGGAGAGGGACAGGAGGG + Intronic
1061340585 9:129977368-129977390 TGGTGGCAAGAGGAACAATAAGG + Intronic
1061619217 9:131800264-131800286 AGGTGGTCAGAGGAGCAAGAAGG - Intergenic
1186233799 X:7485144-7485166 TGGTAGTATCAGGGACAAGGTGG + Intergenic
1186399334 X:9242247-9242269 TGGTGGTAACTGTGACTAGAAGG - Intergenic
1187065535 X:15833749-15833771 TGGTGGTAAGAGGTATAAACTGG - Intronic
1188433135 X:30129561-30129583 TGGGGGGAAGAGGGGGAAGAGGG + Intergenic
1189549080 X:42074663-42074685 TGGTGGAAAGAGGGAGAAGTTGG + Intergenic
1189643242 X:43097636-43097658 TGGTGGAAAGAAGGAAGAGAAGG - Intergenic
1189660564 X:43292548-43292570 TGTTAGGAAGATGGACAAGAGGG - Intergenic
1191085790 X:56565379-56565401 TGGGGGTAAAAGGGACTATAGGG - Exonic
1191762977 X:64664204-64664226 TTGTTGTGAGAGGGACAGGATGG + Intergenic
1193603827 X:83541796-83541818 CTGTGGAAAGAGGGCCAAGAGGG + Intergenic
1193747393 X:85298688-85298710 TTCTGGAGAGAGGGACAAGATGG - Intronic
1195594997 X:106677998-106678020 TGGAGGGAAGAGGGAGAGGATGG + Intronic
1195621099 X:106955841-106955863 TCTTGGAAAGAGGGTCAAGAGGG + Intronic
1200312631 X:155094479-155094501 TGCTGGTAGGAGGAACAAAAGGG + Intronic
1202578388 Y:26351852-26351874 TTGAGTTAGGAGGGACAAGAAGG - Intergenic