ID: 1054282522

View in Genome Browser
Species Human (GRCh38)
Location 9:63138378-63138400
Sequence CTGGTGGTAAGAGGGACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 7, 1: 2, 2: 0, 3: 26, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282522_1054282533 20 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282522_1054282535 21 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282522_1054282532 16 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282532 9:63138417-63138439 TCTATCCACATATCACCCCTTGG No data
1054282522_1054282539 27 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282522_1054282537 25 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282522_1054282536 22 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282522_1054282538 26 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282522 Original CRISPR CTGGTGGTAAGAGGGACAAG AGG (reversed) Intergenic
900637454 1:3672902-3672924 CTGGGGGTAAGCGGGTCAGGAGG - Intronic
902132509 1:14275171-14275193 CTGGTGGGGAGAGGGAGATGTGG - Intergenic
902457804 1:16548377-16548399 CTGGTGCTAAGAGGGAGTAGGGG - Intergenic
902475251 1:16680718-16680740 CTGGTGCTAAGAGGGAGTAGGGG - Intergenic
902494356 1:16859536-16859558 CTGGTGCTAAGAGGGAGTAGGGG + Intronic
904885307 1:33733271-33733293 CAGGTGGTAAGGGGCACAGGTGG - Intronic
905178899 1:36155057-36155079 CTGGAGGGAAGGGGGGCAAGGGG + Intronic
905797143 1:40822291-40822313 CTGGTGGTATGGGGGACGTGGGG - Intronic
906192282 1:43905903-43905925 GTGGTGGGAAGAGGAACAGGAGG - Intronic
906192425 1:43906409-43906431 GTGGTGGGAAGAGGAACAGGAGG - Intronic
908164960 1:61448837-61448859 TTGGTGGTAAGAGAGACACTAGG + Intronic
911446568 1:98000988-98001010 CTGAAGGTAAGATGGTCAAGTGG + Intergenic
912967790 1:114251370-114251392 CTGGTGGTAACAGGATCAGGTGG - Intergenic
913546544 1:119874389-119874411 TTGGTGGAAACAGGGACAAGTGG + Intergenic
913611604 1:120514549-120514571 CTGATGCTAAGAGGGAGTAGGGG - Intergenic
913983188 1:143542258-143542280 CTGATGCTAAGAGGGAGTAGGGG + Intergenic
914228326 1:145741235-145741257 CTGGTTGAAAGAGGAAGAAGAGG + Exonic
914579588 1:149007690-149007712 CTGATGCTAAGAGGGAGTAGGGG + Intronic
914649552 1:149686155-149686177 CTCTTGGTCAGAGGGACCAGGGG - Intergenic
914944767 1:152054000-152054022 CCGGTGGTAATAGGAACGAGAGG - Intergenic
915068400 1:153245092-153245114 ATGGTGGTAAGAGTGAGCAGAGG + Intergenic
915129447 1:153686745-153686767 CTGCAGGTGAGGGGGACAAGGGG + Exonic
915167622 1:153957462-153957484 CTGGAGGTCAGAGGGACCAAGGG - Intronic
915708099 1:157866041-157866063 CTGGGGGTGACAGGGACAGGTGG - Intronic
915834980 1:159169580-159169602 CTGGATGTAAGAGAGAGAAGAGG - Intergenic
916190399 1:162172172-162172194 GTTGTGGGGAGAGGGACAAGAGG + Intronic
916576451 1:166071187-166071209 CTGGTGGAAAGAAGGGCAAAAGG + Intronic
917303893 1:173607755-173607777 CTGGGGGCAAGAGGAAGAAGAGG + Intergenic
917535577 1:175872151-175872173 CTGGGGGACAGGGGGACAAGTGG + Intergenic
918623867 1:186635975-186635997 CTGCTTTGAAGAGGGACAAGAGG + Intergenic
919007472 1:191916624-191916646 TAGGTGTTAAGAGGGACAACTGG + Intergenic
919143180 1:193599493-193599515 CTTCTTGTAAGAGGCACAAGAGG - Intergenic
919910110 1:202106015-202106037 CTGGGGATAAGAGGGACCTGCGG - Intergenic
920116599 1:203626209-203626231 CTGGTGGGTACAGGGACAAGAGG + Intergenic
921328446 1:214011367-214011389 ATGGTGGCAAGAGAGGCAAGAGG - Intronic
1063693729 10:8312590-8312612 GTGGTGGTAAGAGGGACCCCAGG + Intergenic
1064683381 10:17834312-17834334 CTGGGGGTTCGAGGGACAGGAGG - Intronic
1066581607 10:36887809-36887831 CAGGTGGTAAGATGGCCTAGTGG + Intergenic
1070279138 10:75036261-75036283 CTGGTGCTAAGACAGAGAAGGGG - Intergenic
1070528922 10:77319243-77319265 GGGGTGGGATGAGGGACAAGAGG - Intronic
1070828213 10:79403519-79403541 CAGGCGGTCAGAGGGACAGGTGG + Intronic
1070850103 10:79556627-79556649 CAGGTGGTCAGAGGGCCCAGTGG - Exonic
1070854357 10:79594718-79594740 CAGGTGGTCAGAGGGCCCAGTGG - Intergenic
1071710082 10:88041469-88041491 ATGGTGGTGAGAGGGAGGAGGGG + Intergenic
1073250650 10:102118802-102118824 CTGGTAGAAAGAGGGACGACGGG + Intronic
1073311548 10:102546391-102546413 CTGGTGGTAACTGGGGCCAGTGG - Intronic
1074472370 10:113738927-113738949 CTGGTTATAAGAGGGGGAAGAGG + Intergenic
1075075526 10:119347916-119347938 CTGGAGGAGAAAGGGACAAGTGG - Intronic
1076260186 10:129059008-129059030 CTGGTGTGAGGAGGGACAAGGGG + Intergenic
1077131761 11:976498-976520 CTGGTGGCAGGAGGGCGAAGGGG + Intronic
1078055554 11:8006261-8006283 CTGGTGATAAGGGGAATAAGGGG - Intergenic
1078158291 11:8817504-8817526 CTGGTGGTAGGAGAGGCAGGGGG - Intronic
1083291909 11:61695202-61695224 CGGGTGGGAGGAGGGGCAAGAGG + Intronic
1087186435 11:95203079-95203101 CTTGGTGTATGAGGGACAAGTGG + Intronic
1087530937 11:99381219-99381241 CTGGAGCCAACAGGGACAAGAGG + Intronic
1088484215 11:110325418-110325440 CTGGTGGGCAGAGACACAAGCGG - Intergenic
1088685181 11:112279316-112279338 CTGGGGTTCAGAGGGACAGGAGG - Intergenic
1091351107 11:134895256-134895278 CGGGTGGGATGAGGGAGAAGAGG - Intergenic
1092744310 12:11659370-11659392 ATGGTGGTAGGAGGGACAGGTGG - Intronic
1093568719 12:20640459-20640481 CTGGCGTTTAGAGGGACAGGAGG + Intronic
1095977880 12:47952128-47952150 CCTGTGGGAAAAGGGACAAGGGG + Intergenic
1097232964 12:57523139-57523161 CTGGCAGTGAGAGGGAGAAGCGG - Intronic
1097762577 12:63484936-63484958 CTGGGGGAATGGGGGACAAGGGG + Intergenic
1098251796 12:68577825-68577847 TTGGAGGGAGGAGGGACAAGGGG - Intergenic
1098391176 12:69971488-69971510 CGGGTGGTGAGAGGGACTGGTGG - Intergenic
1101154790 12:101917241-101917263 CTGGAGGTAAGAGGTAAAGGAGG + Intronic
1101823542 12:108202710-108202732 AGGGTGGTAGGAGGGAGAAGAGG + Intronic
1103362475 12:120362113-120362135 CTGGTGGTGTGGGGGACCAGAGG - Intronic
1104416956 12:128603484-128603506 CTGGAGGGGAGAGGCACAAGTGG - Intronic
1104498707 12:129264909-129264931 TTGGGGGTAAGAGTGAGAAGGGG + Intronic
1105584388 13:21730554-21730576 CTGGTGAGAAGAGGTAAAAGGGG + Intergenic
1113760093 13:112840857-112840879 GTGGTGGTGGGAGGGACATGGGG - Intronic
1115887901 14:37994216-37994238 ATGCTTGGAAGAGGGACAAGTGG - Intronic
1117086363 14:52206087-52206109 CAGGTGGAAGGAGGGACAAGAGG - Intergenic
1119053022 14:71389235-71389257 CTGGAGAGAAGAGGGACCAGTGG + Intronic
1121687152 14:95844916-95844938 GGGGTGGAAGGAGGGACAAGAGG - Intergenic
1122238961 14:100349257-100349279 ATGGTGATAATAGGGACAAAGGG - Intronic
1122415703 14:101548587-101548609 CAGGTGGGAAGGGGCACAAGTGG + Intergenic
1122855133 14:104556460-104556482 CTGGAGGGACGAGGGACTAGGGG + Intronic
1123702223 15:22923508-22923530 CTGCTGGTAAGAAGGAGAAATGG + Intronic
1128156555 15:65395259-65395281 CTGGTGACACGGGGGACAAGGGG + Intronic
1128959999 15:71992397-71992419 CTGGTGCTAAGAGATACAACGGG + Intronic
1129661666 15:77556257-77556279 CTAGGGGTAAAAGGGACATGGGG - Intergenic
1133877982 16:9752693-9752715 CTTATGGCAAGAGGGAAAAGGGG - Intergenic
1134075744 16:11290253-11290275 ATGGAGGTAACTGGGACAAGTGG + Intronic
1135113891 16:19710148-19710170 CTGCTAGGAACAGGGACAAGAGG - Intronic
1138661343 16:58519888-58519910 CTGGTGGTGAGGAGGAAAAGTGG - Intronic
1139369511 16:66458101-66458123 ATGCTGGTTAGAGGGAGAAGGGG - Intronic
1139484919 16:67249970-67249992 CTGGTGGGAGGAGGGACCACTGG - Intronic
1142993537 17:3747659-3747681 CTGTTGGGAAGAGGGACACTGGG - Intronic
1143344497 17:6240007-6240029 CTGGTGGCTAGAGGGAAAGGTGG - Intergenic
1143545260 17:7591622-7591644 CTGGGGGTAGGGTGGACAAGAGG + Exonic
1143724676 17:8836962-8836984 GTGGAGGTAAGAGGGAGGAGGGG + Intronic
1143931885 17:10437823-10437845 CTGATGGTGGGAAGGACAAGGGG + Intergenic
1144944468 17:18962734-18962756 CTGGAGGTGAGAGAGACAAGAGG + Intronic
1146288381 17:31590418-31590440 TTGGTGGTACAAGGTACAAGTGG - Intergenic
1146948983 17:36892750-36892772 CTGGTGGGATGAGGGAGCAGGGG - Intergenic
1147609525 17:41793403-41793425 CTTGTGGAAAGAGGGAGGAGCGG - Intergenic
1147965497 17:44192367-44192389 CTGGTTGGAGGAGGGAGAAGTGG - Exonic
1148235529 17:45965987-45966009 TTGGTGGAAAGAGTGACAAGGGG - Intronic
1148372874 17:47114185-47114207 CTGATTTTAACAGGGACAAGTGG - Intergenic
1148731566 17:49839910-49839932 CTGGTGGTGGGAGAGAGAAGTGG + Intronic
1148788381 17:50158061-50158083 CTGGTGGTGAGAGGATCAATTGG - Intergenic
1148814720 17:50319254-50319276 CTGATAGTAATAGGGATAAGAGG + Intergenic
1149295177 17:55255610-55255632 CTGATGGTTAGAGGGAAAGGAGG - Intergenic
1150306988 17:64093939-64093961 CTGGTGGTCACAGAGACTAGCGG + Intronic
1151809234 17:76427137-76427159 ATGGTGGTATGAGGGCCCAGTGG - Intronic
1152098789 17:78288767-78288789 CTATTGTTAAGAGGTACAAGGGG + Intergenic
1153160534 18:2199910-2199932 CTGGTGGGAAGAGGTAGGAGGGG + Intergenic
1157150453 18:45212103-45212125 CTGGGGTGAAGAGGGAAAAGTGG + Intergenic
1158522123 18:58180239-58180261 CTTGTGCAAAGAGGGAGAAGGGG - Intronic
1159519247 18:69496371-69496393 CTGGTGGTAGCCGGGACAAGTGG - Intronic
1160900676 19:1426547-1426569 CCGGAGGTGAGAGGGACAGGAGG + Intronic
1161315568 19:3615743-3615765 CTGGCGGACAGAGGGTCAAGAGG + Intronic
1161439804 19:4284550-4284572 CTGGTGGCAAGGAGCACAAGGGG - Intronic
1163752792 19:19088123-19088145 CTCCTGGTAAGAGGCAGAAGAGG - Intronic
1163839169 19:19595386-19595408 CGTGTGGTAAGCTGGACAAGCGG - Intronic
1165694554 19:37891135-37891157 CAGGTGGGAAGAGAGATAAGTGG - Intronic
1166679705 19:44759073-44759095 CTGGGGGTATGAGGGAGGAGGGG - Intronic
1167017400 19:46850117-46850139 CTGGAGGTAAGATGGACACTCGG - Intronic
1167455098 19:49593658-49593680 CTGATGGTAACAGGGCCAATTGG - Intronic
1167462934 19:49635853-49635875 CTGGGGGTAGGGGGGACACGGGG + Intronic
1168557054 19:57351927-57351949 CTGGTGAGAACAGGGACTAGGGG + Intronic
926153331 2:10436456-10436478 CTGGGGGTGAGGGGGGCAAGTGG - Intergenic
927037306 2:19191970-19191992 CAGGTGGTGAGAAGGAAAAGGGG + Intergenic
927923401 2:26991448-26991470 GTGGTGGTGATAGGGAGAAGAGG + Intronic
928762515 2:34601431-34601453 CTGTGGGGAAGAGGGACAAGGGG + Intergenic
930053913 2:47237539-47237561 CTGGAGGTAGGAGGGAGAGGGGG + Intergenic
931321031 2:61175248-61175270 CTGGCGACAAGAGGGACAAGTGG - Intergenic
933154960 2:78963165-78963187 CTGGTGGTCGGAGGGAGAGGAGG + Intergenic
933764843 2:85699667-85699689 TTGGTGGGAAGAGGGAAAAATGG + Intergenic
933906924 2:86903305-86903327 TTGGTGGTAAGAGGAACATATGG - Intergenic
934024553 2:87990347-87990369 TTGGTGGTAAGAGGAACATATGG + Intergenic
934476873 2:94599524-94599546 CTGGTGGCAAGAGGGACAAGAGG - Intronic
934813655 2:97305665-97305687 CAGGTGGCAAGAGGGCCTAGTGG + Intergenic
934824040 2:97402815-97402837 CAGGTGGCAAGAGGGCCTAGTGG - Intergenic
935631625 2:105216939-105216961 CAGGTGGTCAGGGTGACAAGGGG - Intergenic
935942947 2:108260381-108260403 CTTGTGGTAAGAAAGCCAAGTGG + Intronic
936365243 2:111848376-111848398 TTGGTGGTAAGAGGAACATATGG + Intronic
938829549 2:135036852-135036874 ATGGTGCTAAGAGGTAGAAGCGG + Intronic
939597784 2:144148669-144148691 CTGGTGGGTAGGGGGACATGTGG - Intronic
939926791 2:148184901-148184923 CTGGTGGGATCAGGGAGAAGCGG - Intronic
941001001 2:160203838-160203860 CTGGTTGTCAGAGGGACATGAGG - Intronic
942545336 2:177057473-177057495 CTGATGGTGGGATGGACAAGAGG + Intergenic
943038763 2:182778728-182778750 CTGGTGTTAAGTGTGACAAGTGG - Exonic
943052945 2:182938604-182938626 CAGGTGGTAAGATGAAAAAGAGG + Intronic
943153489 2:184144627-184144649 CTGTTGGTGAGAGAGAGAAGTGG + Intergenic
945136004 2:206628014-206628036 CTGTGGGTAAGAGAGGCAAGAGG + Intergenic
946031382 2:216707833-216707855 CTGGTGACAAGGGAGACAAGAGG + Intergenic
948671562 2:239571779-239571801 CTGATGGGAAGAGGGAGAAGAGG + Intergenic
948839285 2:240641266-240641288 CAGGTGGTCTGAGGGAGAAGCGG + Intergenic
1169564557 20:6839719-6839741 CAGGTGGTAAGAGGGATATATGG - Intergenic
1170324355 20:15139838-15139860 CTGGTGGTGACATGCACAAGTGG + Intronic
1172669799 20:36627153-36627175 CTGGTGGGCAGAGGGTCCAGAGG + Intronic
1172696164 20:36824489-36824511 CTGGGGGCAAGAGGGAAAGGGGG + Intronic
1173154963 20:40601030-40601052 CTGGTGGGGAGAGGGATTAGGGG - Intergenic
1173253619 20:41377437-41377459 CTGGAGGGAAGAGGGGCAGGAGG + Intergenic
1175445467 20:59016587-59016609 CTGGTGGGGACAGAGACAAGGGG + Intergenic
1177125822 21:17192155-17192177 CTGGGGGTGATGGGGACAAGAGG - Intergenic
1177286161 21:19053441-19053463 GTGGTGTTAAGAGGGTAAAGAGG - Intergenic
1177588942 21:23136560-23136582 GGTGTGGTAACAGGGACAAGGGG - Intergenic
1178562415 21:33651182-33651204 CTGGGGGCAAGAGAGACAGGTGG + Intronic
1178989917 21:37344293-37344315 CTGCTGGTAGGAAGGTCAAGAGG + Intergenic
1179509584 21:41863586-41863608 CTGGTGGTAAACGGGAAATGGGG + Intronic
1179997900 21:44982298-44982320 GTGGTGTTAAGAGGGACAGCGGG + Intergenic
1182124117 22:27804132-27804154 CTGGAGGAAATAGGGAAAAGTGG + Intergenic
1182371214 22:29812404-29812426 TTGGTGCTAAGAGGGCAAAGTGG + Intronic
1182476156 22:30577445-30577467 CTGGTGGAAAGGGGTACAACAGG + Intronic
1182804271 22:33057620-33057642 CTGGGGCTAAGAGGGACAGTAGG - Intronic
1184409721 22:44319537-44319559 CTGGTGGGAAATGGGACCAGTGG - Intergenic
949691852 3:6649934-6649956 ATGCTGGTAAGAGAGTCAAGAGG - Intergenic
950046117 3:9949501-9949523 CTGGTGGTCTGAGGGAGAAGTGG + Exonic
952156655 3:30650590-30650612 CTGGTGGAAAGAGGGGCTTGGGG + Intronic
952974989 3:38686168-38686190 CTGGCGGGAAGGAGGACAAGAGG + Intergenic
953016360 3:39080628-39080650 CCTTTGGTAGGAGGGACAAGTGG + Intronic
953124610 3:40078668-40078690 CTGCTGGTAAGAGAGACTAGTGG + Intronic
954224330 3:49172613-49172635 CTGGAGGAAAGAGGGAAAACAGG - Intronic
955316737 3:57945442-57945464 CTAGTGGATAGATGGACAAGTGG + Intergenic
956967054 3:74474148-74474170 CTGGTGGGAAGAGTGAGCAGTGG + Intronic
957705421 3:83774370-83774392 CTTGAGGTGTGAGGGACAAGGGG + Intergenic
958951888 3:100425680-100425702 TTGGGTGTAAGAGGGACAAAAGG + Intronic
960419396 3:117425376-117425398 CTGGTGGTGAGAGGTATAAGTGG + Intergenic
962637674 3:137347464-137347486 CTGATGATAAGTGTGACAAGAGG + Intergenic
963444252 3:145383370-145383392 GGGGTGGTAAGAAGGAAAAGAGG + Intergenic
963564820 3:146916126-146916148 CTGGTGGGAAGAAGAAGAAGAGG + Intergenic
965674977 3:171184975-171184997 CTGGTGGGGAGTGGGATAAGGGG + Intronic
968155546 3:196378229-196378251 CTATAAGTAAGAGGGACAAGGGG - Intronic
969050716 4:4370904-4370926 CAGGTGGCATGAGGGAGAAGGGG + Intronic
969691278 4:8705468-8705490 CTGGTGGTCAGAGCTAGAAGGGG + Intergenic
971154191 4:24064484-24064506 GTGGTGGTGACAGGGAGAAGAGG + Intergenic
974612452 4:64233339-64233361 ATGCTTGTAAGAGGGCCAAGTGG + Intergenic
974817129 4:67019894-67019916 CTGGTGGAAAGAGTGAGAATGGG + Intergenic
975724333 4:77277491-77277513 CTGGTGGCAAGAGGGATATCTGG + Intronic
976095933 4:81508225-81508247 CTGGTGATACGTGTGACAAGAGG + Intronic
976498526 4:85758651-85758673 CAAGTGGGAAGATGGACAAGGGG + Intronic
978075321 4:104521964-104521986 CTAGTGCAAAGAGGGAAAAGGGG - Intergenic
978390598 4:108221237-108221259 CGGGTGGTATGTGTGACAAGGGG + Intergenic
979576019 4:122293532-122293554 CTGGTGGTAGGACTCACAAGGGG - Intronic
984787411 4:183581346-183581368 CTGGTGGGAAGAGGAAGCAGAGG - Intergenic
985631661 5:1017250-1017272 ATGGTGGGCAGAGGGACATGGGG - Intronic
990355359 5:54961269-54961291 CAGGTGCTAAGAGGCACATGAGG + Intergenic
991569744 5:68041527-68041549 CTGGTGGTAAGAGAGAGGAAAGG + Intergenic
995527608 5:113063053-113063075 CTGGTGATAAGAGGGAAACCTGG - Intronic
996572689 5:124949141-124949163 GTGTTGGTCAGAGGAACAAGGGG + Intergenic
999143551 5:149378353-149378375 CTGGTGCTGGGAGGGAGAAGTGG - Intronic
999670839 5:153958076-153958098 TGGGTGGTAAGAGAGGCAAGGGG - Intergenic
1000172000 5:158711805-158711827 CTGGTGGTAACTGGTAGAAGTGG + Intronic
1001446945 5:171792969-171792991 CTGGAGGTAATAGGAAAAAGGGG - Intronic
1001941247 5:175741191-175741213 GTGCTGGCAAGAGTGACAAGAGG - Intergenic
1002041421 5:176517431-176517453 CTTGTGGGAACAGAGACAAGGGG - Intergenic
1003716536 6:8652636-8652658 CAGGTGGTAAGAGGGGCTAATGG - Intergenic
1006263992 6:32901318-32901340 CTTGTGTTAAGAGTGACATGTGG - Intergenic
1006739072 6:36294394-36294416 CTGGTGGTGAGAGGCAGGAGGGG + Exonic
1007826672 6:44605988-44606010 CTGGTGAAAAAAGGGAGAAGCGG + Intergenic
1007889429 6:45272299-45272321 CAGGTTGTGGGAGGGACAAGTGG + Intronic
1012199112 6:96383531-96383553 CTGGAAGCAGGAGGGACAAGGGG + Intergenic
1014311310 6:119805492-119805514 TTAGTGGGAAGAGGAACAAGAGG - Intergenic
1014492455 6:122079385-122079407 CTGGTTGTGTGAGGGGCAAGTGG + Intergenic
1017568517 6:155715006-155715028 CTGGGGGTAACAGGGTCAAACGG - Intergenic
1018335883 6:162788609-162788631 CTGCTGGTAAGAATGACAAATGG - Intronic
1018372184 6:163178329-163178351 CTTATGGTCAGAGGGACAAGGGG + Intronic
1018402044 6:163433078-163433100 ATGTTGGTAAAAGGCACAAGAGG + Intronic
1020013584 7:4818799-4818821 CTGGTGGGAAGAGGGAAACGGGG + Intronic
1020429402 7:8104017-8104039 GTGGTGGGAAAAGGGACCAGAGG + Intergenic
1020904369 7:14047001-14047023 CTGGTAATAAGAGGCACAAATGG - Intergenic
1021360448 7:19706451-19706473 CTGGTGGAAGGGGGGACATGTGG + Intronic
1022081901 7:27030672-27030694 CTGGTGGTAACAGGTACAGAGGG + Intergenic
1022207124 7:28175566-28175588 CTGGTCATAAGGGGGACAAGTGG + Intronic
1022482476 7:30752974-30752996 CTGGTGGTCTGTGGGATAAGAGG + Intronic
1024030084 7:45453631-45453653 CTGGTGGTAGGAGGCAAGAGAGG + Intergenic
1024909078 7:54424014-54424036 CTGGTGTTAAGAGGGATGAGTGG + Intergenic
1025858317 7:65303740-65303762 CCAGTGGTGAGAGGGACATGTGG - Intergenic
1027266081 7:76495990-76496012 CGGGTGGAGAGAAGGACAAGCGG - Intronic
1027317459 7:76994107-76994129 CGGGTGGAGAGAAGGACAAGCGG - Intergenic
1028192605 7:87870433-87870455 CTGATGATGATAGGGACAAGAGG + Intronic
1032273289 7:130431460-130431482 CTGCTGGGAAGACAGACAAGTGG + Intronic
1033303270 7:140205331-140205353 CTGATGGAAAGAGGGAGAACAGG + Intergenic
1033810153 7:145002376-145002398 GTGGTGGGAAGATGGACCAGTGG + Intergenic
1034367899 7:150567761-150567783 CTGGTGGGAAGAGGAACATTGGG + Intronic
1035458938 7:159027508-159027530 CAGGTGGGAAGGGGGAGAAGGGG - Intergenic
1035897791 8:3423556-3423578 CTGGTGATAAGATAGACAAATGG - Intronic
1036203441 8:6787936-6787958 CTGCTGGGAGGAGGGACAGGAGG + Intergenic
1037777180 8:21843155-21843177 CTGGTGGTCAGCCAGACAAGTGG - Intergenic
1038386712 8:27155234-27155256 ATTGGGGTAAGAGGGACAACTGG - Intergenic
1039352524 8:36778916-36778938 CTGGTGGGAAGAGACACAAGTGG - Intergenic
1041279955 8:56199165-56199187 CTGGTGGTTGGGGGGACAGGTGG + Intronic
1044210457 8:89544038-89544060 CTTTTGGTAAAAGGTACAAGAGG - Intergenic
1044752538 8:95430191-95430213 CTGGTGGGAAGAGGAAAAGGTGG + Intergenic
1046151944 8:110238847-110238869 TTGCTGGAAAGAGGGACAACTGG + Intergenic
1046278588 8:111994190-111994212 CTGGTGGTTACAAGGAAAAGGGG - Intergenic
1046806197 8:118481438-118481460 CTGGTAGGAAGAAGGAAAAGAGG + Intronic
1046983630 8:120363415-120363437 CTGTTGGGAGGAGGGGCAAGGGG + Intronic
1048062448 8:130934567-130934589 CTGGTGTAAAGGGGGACAATGGG - Intronic
1049635777 8:143688376-143688398 CTGGAGGTGGGAGGGACGAGGGG + Intronic
1050987341 9:12100306-12100328 GTGGTGGAAAGAGGGCCAAGTGG - Intergenic
1051070410 9:13159403-13159425 CTGGTGGGAAGAGCTCCAAGAGG + Intronic
1051351646 9:16203390-16203412 CTGGAGGGAAGGGGGAAAAGGGG + Intergenic
1052853154 9:33390382-33390404 CTGGTGGTGAGAGGGACAAGAGG + Intronic
1053681192 9:40486556-40486578 CTGGTGGTAAGAGGGACAAGAGG + Intergenic
1053931181 9:43114880-43114902 CTGGTGGTAAGAGGGACAAGAGG + Intergenic
1054282522 9:63138378-63138400 CTGGTGGTAAGAGGGACAAGAGG - Intergenic
1054294279 9:63322071-63322093 CTGGTGGTAAGAGGGACAAGAGG + Intergenic
1054392301 9:64626560-64626582 CTGGTGGTAAGAGGGACAAGAGG + Intergenic
1054426949 9:65131771-65131793 CTGGTGGTAAGAGGGACAAGAGG + Intergenic
1054503426 9:65889769-65889791 CTGGTGGTAAGAGGGACAAGAGG - Intronic
1056853018 9:90100151-90100173 GTGGTGGGAAGAGGGCCAAGGGG + Intergenic
1057020772 9:91696035-91696057 CTGGTGGGCAGAGGGACCTGGGG - Intronic
1059392159 9:114006070-114006092 CTGGTGGTGGGAGGGAGAGGTGG + Intronic
1059548088 9:115199235-115199257 ATGGTGGGGAGAGGGACAGGAGG + Intronic
1059798291 9:117723913-117723935 CATATGGTAAGAGGCACAAGGGG - Intergenic
1062505228 9:136870673-136870695 ATGGTGGGCAGAGGGACAGGGGG - Intronic
1062518847 9:136949437-136949459 CAGGTGCTCAGAGGGACAGGTGG + Intronic
1186845181 X:13523766-13523788 TTGGTGGGAACAGGGAGAAGAGG + Intergenic
1186847151 X:13542165-13542187 CTGGGGGAAAGAGTGAGAAGGGG + Intergenic
1192150412 X:68708866-68708888 CTGGTGGGGAGAGTGACAACGGG - Intronic
1192432340 X:71120948-71120970 CTGGAGGAAAGAGGGAAAAAGGG - Intronic
1193644234 X:84047372-84047394 CTGATTGTAATAGGGACAGGTGG + Intergenic
1195621098 X:106955840-106955862 CTCTTGGAAAGAGGGTCAAGAGG + Intronic
1197586707 X:128356995-128357017 CATGTAGTATGAGGGACAAGGGG - Intergenic
1199168241 X:144703083-144703105 CTAGTGGAAAGCAGGACAAGGGG - Intergenic
1202143531 Y:21754018-21754040 CTGATGGAAAGAGGCACAAATGG - Intergenic