ID: 1054282523

View in Genome Browser
Species Human (GRCh38)
Location 9:63138386-63138408
Sequence TAATGGGTCTGGTGGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 6, 1: 3, 2: 0, 3: 13, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282523_1054282539 19 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282523_1054282532 8 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282532 9:63138417-63138439 TCTATCCACATATCACCCCTTGG No data
1054282523_1054282538 18 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data
1054282523_1054282535 13 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282523_1054282537 17 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282523_1054282533 12 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282523_1054282536 14 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282523 Original CRISPR TAATGGGTCTGGTGGTAAGA GGG (reversed) Intergenic
903922659 1:26811812-26811834 TTGTGGGTCTGGTGGCAACAAGG - Intergenic
904289315 1:29473914-29473936 TTATGAGTCTGGTGGTGAAAAGG + Intergenic
904386940 1:30149034-30149056 TACAGGGTTTGGTGGTGAGAGGG - Intergenic
905518061 1:38576711-38576733 GAATTGGTCTTGTGGTGAGATGG - Intergenic
907953424 1:59206110-59206132 TTATGGCTCAGGTGGTCAGATGG + Intergenic
908266837 1:62387531-62387553 TAATGGCTCCCGAGGTAAGATGG + Intergenic
909016542 1:70385962-70385984 TAAAGGGTTTGGGGGTAACATGG - Intergenic
913042405 1:115040218-115040240 GAATGAGGCTGGTGGGAAGATGG - Intergenic
919562651 1:199141141-199141163 TAAAGGGGTTGGTGGTGAGATGG - Intergenic
1062969030 10:1631625-1631647 GAATGGGTCTGGTGATTTGATGG + Intronic
1063750357 10:8937528-8937550 TAATCTGCCTGGTGGTAATAAGG + Intergenic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1065007267 10:21391473-21391495 TAATGGGCATGGTGGGAGGAGGG + Intergenic
1066535745 10:36389614-36389636 TCATGGGTGTGGTGGAAACATGG + Intergenic
1067469023 10:46523066-46523088 TCAAGGGTATGGTGGTGAGAAGG - Intergenic
1068403862 10:56564560-56564582 GTATGGGTTTGGTGGTAAAAAGG + Intergenic
1071452390 10:85810034-85810056 TAGTGGCTCTGGTTTTAAGATGG - Intronic
1071452424 10:85810178-85810200 TAGTGGCTCTGGTTTTAAGATGG - Intronic
1074243079 10:111658398-111658420 AAATGGGTTTGGTGGTGAGAAGG - Intergenic
1074874723 10:117604778-117604800 TAATGTGCCTGGTGGAGAGAGGG + Intergenic
1080580460 11:33638183-33638205 TCATTGGTCTGGTGGTTATAAGG - Intronic
1081757465 11:45554734-45554756 TCATGGGTGTGGTGCTGAGACGG - Intergenic
1081808289 11:45901676-45901698 CAATGTGTGTGGTGGCAAGAGGG - Intronic
1083789536 11:64975682-64975704 TGAAGGGTCAGGTGGTCAGATGG - Intergenic
1084257034 11:67950215-67950237 TGATGGGTCTGGGGCTAGGAAGG - Intergenic
1084775724 11:71373609-71373631 TTATGTATCAGGTGGTAAGAGGG - Intergenic
1093740867 12:22686196-22686218 AATTTTGTCTGGTGGTAAGAGGG + Exonic
1097756279 12:63410103-63410125 TAATTTGTCTTTTGGTAAGAGGG + Intergenic
1099342767 12:81458808-81458830 TAAAGGGTTTGGTGATAATATGG - Intronic
1101872618 12:108578565-108578587 TAATGGGGCTGGTGATAATGGGG - Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1106233597 13:27842066-27842088 TACTGGGTCAGGTGGTGGGAGGG + Intergenic
1106456899 13:29935594-29935616 TCAAGGGTCTGGAGTTAAGAGGG + Intergenic
1106763452 13:32890788-32890810 CATTGGGTCTGTTGGTAATAAGG + Intergenic
1107023476 13:35775543-35775565 TAATGGGTGTGGGGGAAAAATGG + Intronic
1108847259 13:54693291-54693313 TAATCGGTCTGGAGGTACCAAGG + Intergenic
1110522467 13:76496914-76496936 TAATGACTCTGGTAGTCAGAAGG - Intergenic
1116396715 14:44455478-44455500 CAGTTGGTCTGGTGTTAAGATGG - Intergenic
1117548636 14:56812328-56812350 TAATGGGGATGGTGGTGAGGAGG + Intergenic
1120409823 14:84140439-84140461 TCATAGGCCTGTTGGTAAGAGGG - Intergenic
1121263774 14:92585297-92585319 TAATGGGTCAGCTGGTGAAAGGG + Intronic
1125984597 15:44037823-44037845 TAATGGGATTGGTGGTCAAATGG + Intronic
1126281276 15:46953047-46953069 TAATGGGTCTGTTGAAATGATGG + Intergenic
1127317985 15:57815544-57815566 TATTGGGTTTGCTGGCAAGATGG - Intergenic
1129069144 15:72936747-72936769 TGAGGGGTCTGGGGGTATGAGGG - Intergenic
1130532992 15:84761622-84761644 TGAGGGGTCTGGGGGTAAGCAGG + Intronic
1131078146 15:89511779-89511801 TAATGTGTATGGTGTGAAGAAGG - Intergenic
1134558927 16:15190707-15190729 TAGAGAGTCTGGTGGCAAGATGG - Intergenic
1134919460 16:18102306-18102328 TAGAGAGTCTGGTGGCAAGATGG - Intergenic
1142918329 17:3162272-3162294 TAATGGGCCTGCTGGCCAGAAGG - Intergenic
1144341934 17:14317364-14317386 GAATGGGTCAGGTGGTAGGCAGG + Intronic
1146003265 17:29144343-29144365 GAATGGCTCTGGTGGTGACAAGG - Intronic
1146290610 17:31604181-31604203 AAATGGGTCTGGATTTAAGAGGG - Intergenic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1151991068 17:77574650-77574672 TAATGGGAATGATGGGAAGAAGG - Intergenic
1153061534 18:999955-999977 TAATGTTGCTGGTGGTAGGAAGG - Intergenic
1153419216 18:4885743-4885765 TAAGGGGTCTGACTGTAAGAAGG - Intergenic
1155064908 18:22260253-22260275 TAATGTCTCTAGTGGGAAGAGGG + Intergenic
1157225212 18:45856894-45856916 TAAAAGGCCTGTTGGTAAGAAGG - Intronic
1159023435 18:63161759-63161781 TAGTGCGTCAGGTGGGAAGACGG - Intronic
1164775451 19:30850082-30850104 TAATGGCCCTGGTGGAAAGGTGG - Intergenic
1166073653 19:40401102-40401124 TATTGGGTATGATGGAAAGAGGG - Intronic
925577917 2:5379894-5379916 AAATGTGTCTGGGGGTAAGGAGG + Intergenic
926546195 2:14243239-14243261 TAATGGTTCTGATGGGAAAATGG - Intergenic
926583356 2:14656573-14656595 TAATGGATATGGTTGGAAGAGGG + Intergenic
926885492 2:17594702-17594724 AAACGGGTCTGGTAGCAAGAGGG - Intronic
927508754 2:23631193-23631215 TGATGGGGCAGGTGGTAGGAGGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930636728 2:53814462-53814484 TAATGGGTAGGGTGAGAAGATGG - Intronic
931014211 2:57957043-57957065 TATTGAGTCTTGTAGTAAGAGGG - Intronic
931056679 2:58480225-58480247 TAATGTGTCTGGGTTTAAGAGGG + Intergenic
934476874 2:94599532-94599554 TAATGGGTCTGGTGGCAAGAGGG - Intronic
934678038 2:96263801-96263823 TGATGGGTCTAGTGGTGGGAAGG + Intronic
943167298 2:184346056-184346078 TGATGGGGGTGGTGATAAGAAGG - Intergenic
944012448 2:194989358-194989380 TAATGGGTCTGTTTTTAAGAAGG + Intergenic
944284956 2:197939045-197939067 TAATGGGGGTGGTGGTGAGAAGG + Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
1170716019 20:18831711-18831733 TAATTGGTCTGGGAGTGAGAAGG - Intergenic
1172534846 20:35665011-35665033 TACTGGGTTTTGTGCTAAGAGGG + Intronic
1173261222 20:41438191-41438213 TCAAGGGTCTGATGGTAACAAGG - Intronic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
949547542 3:5084649-5084671 TAATGGATCTGTGGGTATGAGGG + Intergenic
950899396 3:16483515-16483537 TAATGGGTCTGGTGTGCAGCTGG + Intronic
950903411 3:16516477-16516499 GATGGGGTCTGGTGGGAAGAAGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
958752592 3:98210301-98210323 TAATGGGACTGATGGTCAGATGG - Intergenic
959510810 3:107209594-107209616 TAATGGGTTTGGTGGTGACAGGG - Intergenic
959952388 3:112194037-112194059 AAATGGCTCTGGTGTCAAGATGG + Intronic
960133699 3:114084975-114084997 TAATAATTCTGGTGGTAAGTGGG + Intronic
962706599 3:138050523-138050545 TGATGGTGGTGGTGGTAAGAGGG + Intergenic
964693099 3:159475665-159475687 TAATGGGTTTGGGGTTAAGAGGG - Intronic
966101911 3:176279832-176279854 TATTGGGTTTGGTGTTAACAAGG + Intergenic
966462816 3:180196488-180196510 TAATGGCAATGGTGGGAAGAGGG - Intergenic
969242948 4:5913210-5913232 TTATGGGGCTGGTGTAAAGAAGG + Intronic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
970742288 4:19252084-19252106 TAGTGGGTCTGGTTTCAAGATGG + Intergenic
973079396 4:45970989-45971011 TAATGGGTCTGGCTTTAAGATGG + Intergenic
973871639 4:55172216-55172238 TGATGGGTTTGCTGGTAATAAGG + Intergenic
975893124 4:79052772-79052794 TGAAGGGTCTGGTGCCAAGATGG - Intergenic
976841086 4:89433169-89433191 TAATGGGGGTGGGGGTAAAATGG - Intergenic
978665045 4:111172434-111172456 TTATAGGTCTGGAGGTAAAAAGG - Intergenic
978910146 4:114052728-114052750 TAATGGGTTGGGTTGGAAGAAGG + Intergenic
980260921 4:130446339-130446361 TAATGTGTCTACTGGTAAGGTGG + Intergenic
982346977 4:154370701-154370723 TAGTGGATTTGGTGGTAGGAAGG + Intronic
987042089 5:14072419-14072441 TAAAGGGTCTGGTGGCTAAAAGG + Intergenic
989573770 5:42970684-42970706 TATTGGATCAGGTGGTAACAGGG - Intergenic
989986996 5:50712760-50712782 ATATGGATCTGGTGGTCAGAAGG + Intronic
989996471 5:50838839-50838861 TAATGGTCTAGGTGGTAAGAAGG - Intronic
991385095 5:66078666-66078688 TAATGGAACTTGTGGTTAGAGGG + Intronic
991906365 5:71516753-71516775 TAATGGGTCTTTTGGTATTAGGG + Intronic
992526781 5:77619478-77619500 TAATGGGGGTGAGGGTAAGAGGG - Intronic
992818865 5:80473409-80473431 TAAGGGGTCTGGAGCAAAGAAGG + Intronic
996183464 5:120449154-120449176 TTATTGGTCTGGTGGCAGGAAGG - Intergenic
999837602 5:155391485-155391507 TATGGGGTCTGGTGGTGAGAGGG - Intergenic
1000998257 5:167980708-167980730 TAATGGGTAAAGTGGAAAGAGGG + Intronic
1007211802 6:40198248-40198270 TGATGGCTCTGGGGGAAAGAGGG - Intergenic
1009249201 6:61276983-61277005 TAGTGGGCCTGGTGGTAGGAAGG + Intergenic
1010850135 6:80764718-80764740 TCATGGGTTTGGTGGTAGAAGGG + Intergenic
1012341940 6:98137611-98137633 TGTTGTGTCTGGTAGTAAGAAGG - Intergenic
1013265735 6:108495905-108495927 TAATTGCTCAGGTGGAAAGATGG + Intronic
1014349756 6:120325274-120325296 TAATGCTACTGGTGGTAATATGG - Intergenic
1018490643 6:164289105-164289127 TATTGGGTCTGATGGTTGGATGG - Intergenic
1019849639 7:3541557-3541579 TCATGGGTACAGTGGTAAGAAGG - Intronic
1021439084 7:20657682-20657704 TTATTGGTATGGTGGTAACATGG + Intronic
1022945083 7:35275393-35275415 TAAGGGCTATTGTGGTAAGAAGG - Intergenic
1027917312 7:84341932-84341954 TAATTGGTTTGGAGGTGAGAAGG - Intronic
1033372750 7:140726107-140726129 AAATTGATCTGGTGGTTAGAAGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1035828541 8:2669760-2669782 TGGTGAGTCTGGTGGTAAAAGGG - Intergenic
1036522042 8:9500916-9500938 TAAGGTGTCTGGTGATAAGTTGG + Intergenic
1044012943 8:87017131-87017153 AAATTGGTCTGGGGGTAAAACGG + Intronic
1045246000 8:100442169-100442191 AATTAGGTCTGGTGGGAAGAGGG + Intergenic
1046349173 8:112983778-112983800 TAACAGGTCTGGTGTAAAGAAGG + Intronic
1046738384 8:117802094-117802116 TAATGTGTATGATGGAAAGAAGG + Intronic
1049279051 8:141734938-141734960 TACTGGGCCTGGAGATAAGAAGG - Intergenic
1049340619 8:142110550-142110572 TGCTGGGTCTGCTGGTCAGAGGG - Intergenic
1049643140 8:143724573-143724595 GAATGGGGCTGGTGGGGAGAGGG + Exonic
1051159143 9:14186109-14186131 TAATGAGTTTGGTGCAAAGAAGG + Intronic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1051532997 9:18126311-18126333 AAATGGGAATAGTGGTAAGAAGG - Intergenic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1053302043 9:36959170-36959192 AGAAGGGTCTGGTGGGAAGAGGG - Intronic
1053681191 9:40486548-40486570 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1053931180 9:43114872-43114894 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054282523 9:63138386-63138408 TAATGGGTCTGGTGGTAAGAGGG - Intergenic
1054294278 9:63322063-63322085 TAACGGGTCTGGTGGTAAGAGGG + Intergenic
1054392300 9:64626552-64626574 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054426948 9:65131763-65131785 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054503427 9:65889777-65889799 TAATGGGTCTGGTGGTAAGAGGG - Intronic
1055657537 9:78466659-78466681 TAATGGTGCTGTTGGGAAGATGG + Intergenic
1058160866 9:101569270-101569292 TAATGGGTCTCCTATTAAGAAGG + Intergenic
1058596276 9:106618942-106618964 TAATGTGTCTGCTGGTGATAAGG - Intergenic
1185820268 X:3196214-3196236 TAATGGTTCTTGTGGTAATAGGG - Intergenic
1186122406 X:6377912-6377934 TAGTGGGGGTGGTGGTGAGAGGG + Intergenic
1187147531 X:16651168-16651190 TAATGGGACTGATGGTGGGAGGG + Intronic
1188649087 X:32608812-32608834 TAATGGTTATGATGGTAAGGGGG - Intronic
1192780701 X:74291757-74291779 TAATGGCAGTGGTGGTATGAAGG - Intergenic
1195693128 X:107645363-107645385 TGATGGGGCTGGTAGTTAGAAGG + Intronic
1196462160 X:115942659-115942681 TAAAGGGGCAGGTGGTAAAATGG + Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic
1198869992 X:141168017-141168039 GAATGGGTTTGGTGATCAGAAGG - Intergenic
1199889073 X:152057030-152057052 TAATGGGATTGCTGGTCAGATGG - Intergenic