ID: 1054282524

View in Genome Browser
Species Human (GRCh38)
Location 9:63138387-63138409
Sequence TTAATGGGTCTGGTGGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 6, 1: 3, 2: 0, 3: 15, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282524_1054282539 18 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282524_1054282536 13 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282524_1054282533 11 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282524_1054282538 17 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data
1054282524_1054282532 7 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282532 9:63138417-63138439 TCTATCCACATATCACCCCTTGG No data
1054282524_1054282537 16 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282524_1054282535 12 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282524 Original CRISPR TTAATGGGTCTGGTGGTAAG AGG (reversed) Intergenic
904330029 1:29752816-29752838 TAAATGGGTCTGGGGGTGGGTGG + Intergenic
906114069 1:43344321-43344343 ATAAAGGGCCTGGTGGTAGGTGG - Intronic
910284985 1:85543894-85543916 TTCATGGGTCTAGTGGTGAAAGG + Intronic
910480740 1:87655659-87655681 TTCTTGGGTGTGGTGGTATGGGG + Intergenic
911251285 1:95579374-95579396 TTAATGGGTCTGGGAGACAGAGG + Intergenic
912009985 1:104947566-104947588 TTCCTGGGTCTGGAGGTCAGTGG - Intergenic
913306641 1:117435134-117435156 GTAATGGGTCTGGTGTTCAATGG + Intronic
914520691 1:148413111-148413133 TTAATGAGTCTGGTGGTTGGCGG - Intergenic
916907945 1:169309322-169309344 TTAACTGGTCTGGTTGTAAAGGG - Intronic
917640455 1:176978616-176978638 TTTATGTGTGTGGGGGTAAGGGG + Intronic
922013089 1:221612392-221612414 TGAATGGGTCTGATGTGAAGAGG + Intergenic
922717121 1:227883533-227883555 TTAATGGATCTGTGGGAAAGGGG - Intergenic
924555101 1:245111685-245111707 TTAAGGGGTCCAGGGGTAAGGGG + Intronic
1065701686 10:28431836-28431858 TTGAGGGGTCTGGTTATAAGTGG + Intergenic
1069930633 10:71879262-71879284 TTACAGGGGCTGGGGGTAAGGGG - Intergenic
1073181846 10:101588196-101588218 TCATTGGCTCTGCTGGTAAGTGG - Exonic
1074314836 10:112351704-112351726 TCAATGGCTCTGGTAGTAAGAGG - Intergenic
1078633854 11:13030701-13030723 TCAATGGGTCTGGGGGAGAGTGG - Intergenic
1078769240 11:14332135-14332157 TTATTGGGTCGTATGGTAAGTGG - Intronic
1078829450 11:14965571-14965593 GTAATGGGGGTGGTGGTGAGAGG + Intronic
1078843263 11:15098623-15098645 CTAATGTGTCTGTTGGCAAGAGG + Intergenic
1081677892 11:44981558-44981580 TTAATGGTTCTGGAGGTCAGAGG + Intergenic
1088077729 11:105872630-105872652 TTGATGGGGCTGGTGGTGATGGG - Intronic
1088462802 11:110100362-110100384 TAAATGAATCTGCTGGTAAGTGG + Intronic
1089784046 11:120895262-120895284 TTACTGGCTCTGTTGGTATGAGG + Intronic
1089966768 11:122659858-122659880 TAACTGGGTCTGGTGGTGTGCGG + Intronic
1090130627 11:124137770-124137792 TTACTGGGACTGGTGGAGAGGGG - Intronic
1090945631 11:131427005-131427027 GCAATGGTTCTGGTGGTCAGGGG + Intronic
1092029007 12:5268355-5268377 TTAAGGGTTCTGGTGGAAAAGGG + Intergenic
1093740866 12:22686195-22686217 TAATTTTGTCTGGTGGTAAGAGG + Exonic
1094175654 12:27538202-27538224 TAAGTGGGTCTGGAGGAAAGAGG - Intronic
1097756278 12:63410102-63410124 TTAATTTGTCTTTTGGTAAGAGG + Intergenic
1101872615 12:108578551-108578573 ATAATGGGGCTGGTGATAATGGG - Intergenic
1101872619 12:108578566-108578588 ATAATGGGGCTGGTGATAATGGG - Intergenic
1102639588 12:114355257-114355279 TTGATGGGTGTGGTGGTAGTGGG + Exonic
1105494889 13:20921831-20921853 TGCTTGGGTCTGGTGGTATGGGG + Intergenic
1108081762 13:46744514-46744536 GAAATGGGGCTGGTGGAAAGGGG + Intronic
1109384370 13:61607935-61607957 TTCTTGGGTCTGGTGGGTAGTGG + Intergenic
1109887441 13:68560292-68560314 TTATGGGATCTGGTGGAAAGTGG - Intergenic
1111578821 13:90195888-90195910 TTATTGAGTCTGGTTGTCAGGGG + Intergenic
1114429334 14:22647008-22647030 GTAATGGGGATGGTGATAAGTGG - Intergenic
1115090364 14:29567324-29567346 TTAAGGGGTCTGGAGGACAGTGG + Intergenic
1119323960 14:73747674-73747696 TTCATGGGTCTGGTGGGGTGGGG + Intronic
1121315869 14:92960726-92960748 TTAAAGGGGCTGGTGGAAGGCGG + Intronic
1123501934 15:20894607-20894629 TTAATAGGACTTGTGGTAAGTGG - Intergenic
1123559187 15:21468306-21468328 TTAATAGGACTTGTGGTAAGTGG - Intergenic
1123595418 15:21905587-21905609 TTAATAGGACTTGTGGTAAGTGG - Intergenic
1125118384 15:36122665-36122687 TTAACAGGCCTGGTGCTAAGTGG + Intergenic
1129029344 15:72607316-72607338 CTAAAGGATCTGGAGGTAAGAGG + Intergenic
1129373257 15:75110961-75110983 TTAATGGAACTGGTGGCAAGGGG + Intronic
1202967535 15_KI270727v1_random:195465-195487 TTAATAGGACTTGTGGTAAGTGG - Intergenic
1135581671 16:23632614-23632636 TTAATGGGTATGGGGTTTAGGGG + Intronic
1139915699 16:70427180-70427202 TAGATGGGTCTGGTGTTCAGGGG - Intronic
1141531808 16:84651457-84651479 TTAATGTGGCTGGTGGGAACAGG - Intronic
1146270504 17:31482164-31482186 TCACTGGGTTTGGTGGGAAGAGG + Intronic
1148604578 17:48919319-48919341 TGACTGGGGTTGGTGGTAAGAGG + Intronic
1152806176 17:82357395-82357417 TTTATGGGTCTGGGGGTCAGAGG - Intergenic
1152863311 17:82708843-82708865 TGGGTGGGGCTGGTGGTAAGGGG - Intergenic
1152863345 17:82708923-82708945 TGGGTGGGGCTGGTGGTAAGGGG - Intergenic
1152863378 17:82709003-82709025 TGGGTGGGGCTGGTGGTAAGGGG - Intergenic
1153005332 18:493218-493240 TTAATGGGTGCGGTGGTGAGTGG - Intronic
1157864348 18:51167994-51168016 TTGATGGGGCTGCTGGTAATAGG + Intergenic
1168213243 19:54906786-54906808 TTGCTGGATCTGGTGGTAACAGG + Exonic
926369163 2:12163094-12163116 TTAATGGGGGTGGTGGCATGGGG + Intergenic
931056678 2:58480224-58480246 TTAATGTGTCTGGGTTTAAGAGG + Intergenic
931455429 2:62406423-62406445 GGAATGGGTCCTGTGGTAAGAGG + Intergenic
931946373 2:67313095-67313117 TTAAGGGAACTGGTGGTAAGAGG + Intergenic
932751629 2:74375010-74375032 TTAATGGGGCTGTGGGTAGGTGG - Intronic
934476875 2:94599533-94599555 TTAATGGGTCTGGTGGCAAGAGG - Intronic
934736033 2:96690326-96690348 GTGATGGCTCTGGTGGTATGAGG + Intergenic
935488969 2:103694039-103694061 TTACTGGGGCTGTTGGGAAGGGG - Intergenic
936239606 2:110776249-110776271 TTCCTGGGTCTGGGGGAAAGGGG + Intronic
937181028 2:119996639-119996661 TTGCTGGGGCTGGTGGTAAGCGG + Intergenic
937490594 2:122363188-122363210 TGAAAAGGTCTGGTGGGAAGGGG + Intergenic
940468993 2:154068728-154068750 GTAGTGGGGCTGGTGGGAAGTGG + Intronic
944350586 2:198722510-198722532 ATAATTGGTCTTGTGGTATGAGG - Intergenic
945655562 2:212618807-212618829 TTTATGGGTCAGGTGGAAATTGG + Intergenic
946305368 2:218854001-218854023 TAAATGGGTCTGGAGCTCAGAGG - Intergenic
946596214 2:221308351-221308373 TTCATGGGGGTGGTGGCAAGAGG + Intergenic
948975032 2:241458808-241458830 ATAATTGGGCTGGTGGCAAGTGG + Intronic
1171307848 20:24121116-24121138 TTAAGGCGACTGGTGGGAAGGGG + Intergenic
1171846597 20:30281216-30281238 TTTATGGGACTGGTAGAAAGAGG - Intergenic
1172534845 20:35665010-35665032 TTACTGGGTTTTGTGCTAAGAGG + Intronic
1172608750 20:36233467-36233489 ATAATGGGACAGGTGGTATGAGG - Intergenic
1175499539 20:59440126-59440148 TTTACGGGTCCGGTGGTCAGAGG + Intergenic
1179168244 21:38952205-38952227 TTAATGGGTTTGGTGCTTATTGG - Intergenic
949547541 3:5084648-5084670 TTAATGGATCTGTGGGTATGAGG + Intergenic
951788541 3:26452614-26452636 ATCATGGGTCTGGAGGGAAGAGG + Intergenic
953553869 3:43926492-43926514 TTAATGGTTCTGGTTGGCAGGGG - Intergenic
953851398 3:46468002-46468024 TTGGTGGGTTTGGTGGAAAGCGG - Intronic
954749475 3:52805608-52805630 TTTATGGGGCTGGTGGCAATGGG - Intronic
955332507 3:58059350-58059372 TAAATAGGCCAGGTGGTAAGAGG + Intronic
956348243 3:68304763-68304785 TTATTTGGTCAGTTGGTAAGAGG + Intronic
957201383 3:77140527-77140549 TTAGTGAGTATGGTGGTAACTGG + Intronic
959431682 3:106261691-106261713 TTAATGTGTATGGTGAAAAGTGG - Intergenic
959510811 3:107209595-107209617 ATAATGGGTTTGGTGGTGACAGG - Intergenic
960133698 3:114084974-114084996 ATAATAATTCTGGTGGTAAGTGG + Intronic
963750984 3:149179679-149179701 TTAATGGATCTGGTTGTATTTGG + Intronic
963890983 3:150635801-150635823 TTAATGAGTTGGATGGTAAGAGG + Intergenic
964693100 3:159475666-159475688 GTAATGGGTTTGGGGTTAAGAGG - Intronic
965317796 3:167212324-167212346 TCAATGGCTCTGGTGGGAGGTGG - Intergenic
967132637 3:186486636-186486658 TTCCTGGGTCTGCTGGGAAGTGG - Intergenic
970486345 4:16528666-16528688 TTACTGGTTCTGGTGGCAGGTGG - Intronic
973532631 4:51848361-51848383 TTAACAGGTCTGATGTTAAGGGG + Intronic
979307030 4:119158161-119158183 TTTATTGCTCTGTTGGTAAGGGG - Intronic
980509347 4:133764415-133764437 TTAAGTGGTGTGGTGGTAAATGG + Intergenic
983633098 4:169870062-169870084 TTATTGGCCCTGGTGCTAAGAGG - Intergenic
983914359 4:173275680-173275702 TCAATGGGTTTGGAGGAAAGTGG - Intronic
987662483 5:20894755-20894777 TTTTTGGGTCTGGTGGACAGTGG - Intergenic
988761099 5:34310562-34310584 TTTTTGGGTCTGGTGGACAGTGG + Intergenic
989573771 5:42970685-42970707 TTATTGGATCAGGTGGTAACAGG - Intergenic
989814771 5:45722575-45722597 TTAATGGGTGTGATGGTGGGTGG + Intergenic
990217733 5:53552727-53552749 CTAAGGGGTTTGGTAGTAAGTGG + Intergenic
991906364 5:71516752-71516774 TTAATGGGTCTTTTGGTATTAGG + Intronic
992956609 5:81915990-81916012 TGTATGGGTTTGGTGGTGAGGGG + Intergenic
999837603 5:155391486-155391508 GTATGGGGTCTGGTGGTGAGAGG - Intergenic
1000692807 5:164344075-164344097 TTGATGGGAGTGGTGGTTAGGGG + Intergenic
1000834046 5:166133805-166133827 TTAATGAGTGAGGTGGGAAGTGG + Intergenic
1007211803 6:40198249-40198271 TTGATGGCTCTGGGGGAAAGAGG - Intergenic
1008039116 6:46777154-46777176 TTAATGGGAAAGGTGGTAACTGG + Intergenic
1008917105 6:56800123-56800145 TAAATGTGTCTGGTGGTTACAGG - Intronic
1011890375 6:92151779-92151801 TTCATTGGTGTGGTGGTAAATGG + Intergenic
1020787956 7:12592734-12592756 GTAAGAGGTCTGGTGGCAAGCGG + Intronic
1022488094 7:30795655-30795677 TTGATGGTTCTGGAGGTCAGAGG + Intronic
1022797319 7:33742445-33742467 TTAATGGGTTTGGTGGTGAAGGG + Intergenic
1028384533 7:90239890-90239912 TTAATGATTCTGTTGGAAAGAGG + Intergenic
1031650194 7:124279051-124279073 TTAATGGATCTAATTGTAAGAGG + Intergenic
1033457133 7:141512499-141512521 TTAATGGGGACGGAGGTAAGGGG - Intergenic
1034594054 7:152171313-152171335 TTTATGGGCCAGGTGGTAACTGG - Exonic
1039081203 8:33735700-33735722 CTACTGGGGCAGGTGGTAAGTGG + Intergenic
1042686099 8:71442281-71442303 TCAATGGGTCCTGTGGGAAGTGG + Intronic
1043964031 8:86451461-86451483 ATAATGAGTGTGGTGGTAAAGGG + Intronic
1044126722 8:88467729-88467751 CTAATGAGACTGGTGGTAGGGGG - Intergenic
1045245999 8:100442168-100442190 TAATTAGGTCTGGTGGGAAGAGG + Intergenic
1050842380 9:10169117-10169139 TTAATGGGGATGGGAGTAAGGGG - Intronic
1052853152 9:33390373-33390395 TTAATGGGTCTGGTGGTGAGAGG + Intronic
1053681190 9:40486547-40486569 TTAATGGGTCTGGTGGTAAGAGG + Intergenic
1053931179 9:43114871-43114893 TTAATGGGTCTGGTGGTAAGAGG + Intergenic
1054282524 9:63138387-63138409 TTAATGGGTCTGGTGGTAAGAGG - Intergenic
1054294277 9:63322062-63322084 TTAACGGGTCTGGTGGTAAGAGG + Intergenic
1054392299 9:64626551-64626573 TTAATGGGTCTGGTGGTAAGAGG + Intergenic
1054426947 9:65131762-65131784 TTAATGGGTCTGGTGGTAAGAGG + Intergenic
1054503428 9:65889778-65889800 TTAATGGGTCTGGTGGTAAGAGG - Intronic
1054836345 9:69678056-69678078 TTATGGCATCTGGTGGTAAGGGG - Intergenic
1061835087 9:133323429-133323451 TGAATGGGACTGCTGGGAAGGGG + Intergenic
1203787393 EBV:135602-135624 TTAATGGGACTGGGGGTGCGCGG - Intergenic
1185820269 X:3196215-3196237 TTAATGGTTCTTGTGGTAATAGG - Intergenic
1187147530 X:16651167-16651189 TTAATGGGACTGATGGTGGGAGG + Intronic
1188649088 X:32608813-32608835 TTAATGGTTATGATGGTAAGGGG - Intronic
1190507080 X:51136937-51136959 GTAATGGGTCCAGTGGTCAGGGG + Intergenic
1193155760 X:78172358-78172380 TTAATGAGTCTGGGTGCAAGTGG + Intergenic
1195283622 X:103360670-103360692 TAAAAGAGTCTGGTGGTAGGAGG + Intergenic
1196836725 X:119820453-119820475 TTTTTGGGTGTGGTGGTGAGGGG + Intergenic