ID: 1054282525

View in Genome Browser
Species Human (GRCh38)
Location 9:63138394-63138416
Sequence CGGGTGGTTAATGGGTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 7, 1: 2, 2: 1, 3: 10, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282525_1054282538 10 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data
1054282525_1054282533 4 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282525_1054282537 9 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282525_1054282543 26 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282525_1054282532 0 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282532 9:63138417-63138439 TCTATCCACATATCACCCCTTGG No data
1054282525_1054282539 11 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282525_1054282536 6 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282525_1054282544 29 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG No data
1054282525_1054282535 5 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282525 Original CRISPR CGGGTGGTTAATGGGTCTGG TGG (reversed) Intergenic
902999287 1:20253292-20253314 GGGGTGGAGAGTGGGTCTGGAGG + Intergenic
905657029 1:39691841-39691863 CGGGTGGGATATGGGTGTGGGGG - Intergenic
905849827 1:41265437-41265459 GGGGAGGTTACTGGGTATGGTGG - Intergenic
920516081 1:206585431-206585453 GGGGTGGGTGATGGGCCTGGGGG + Intronic
1065696741 10:28387614-28387636 AGGGTGGCAAATGGGTCTGGAGG - Intergenic
1066164493 10:32772088-32772110 CAGGTGGGAACTGGGTCTGGTGG + Intronic
1069215301 10:65812109-65812131 TGGGTGGTCAATGGGACTGGGGG + Intergenic
1070157812 10:73847029-73847051 CGGGAGGCTGATGGGGCTGGTGG - Intronic
1073811349 10:107155677-107155699 CGGGTGGTGGATGGGTCGGTGGG - Intronic
1081882610 11:46466788-46466810 AGGGTGGGTCATGGGGCTGGAGG - Intronic
1085119296 11:73957099-73957121 AGGGTGGGGAGTGGGTCTGGAGG - Intronic
1090155263 11:124430690-124430712 CTGGTGGCTAAGGGGTCTGTGGG + Intergenic
1091080455 11:132662188-132662210 CTTTTGGTTCATGGGTCTGGAGG + Intronic
1094140429 12:27175402-27175424 GGGGTGGATAATGGATCTGAGGG - Intergenic
1098391176 12:69971488-69971510 CGGGTGGTGAGAGGGACTGGTGG - Intergenic
1098579951 12:72087857-72087879 CGGCTGGTAAATGGTGCTGGAGG - Intronic
1102639586 12:114355250-114355272 TGGCTGGTTGATGGGTGTGGTGG + Exonic
1103463650 12:121124641-121124663 CTGGTGGTTACTGAGTGTGGAGG + Intergenic
1103858266 12:123990107-123990129 ATGGTGGTTACTGGGGCTGGGGG + Intronic
1109152749 13:58863882-58863904 CATGTGATTAATGGGTCTAGGGG + Intergenic
1110132364 13:72023211-72023233 CTGGTTGTTTATGGGTCTGTGGG + Intergenic
1113435872 13:110290645-110290667 GGGGTGGAGAGTGGGTCTGGTGG - Intronic
1117702022 14:58423699-58423721 CAGGTGGTTTATGTGGCTGGTGG - Intronic
1120229712 14:81829479-81829501 TGGGTGGTTGATGGGACGGGGGG + Intergenic
1121315867 14:92960719-92960741 TGGGTGGTTAAAGGGGCTGGTGG + Intronic
1133117279 16:3584656-3584678 CGTGTGGTCTCTGGGTCTGGTGG - Intronic
1134447924 16:14344847-14344869 GGGGTGGGGAAGGGGTCTGGAGG - Intergenic
1136405727 16:30045819-30045841 CGGGTGGTCAATGGGTGTTCAGG + Intronic
1138203049 16:55104403-55104425 AGGGTGGAGACTGGGTCTGGTGG - Intergenic
1138727102 16:59151888-59151910 GGGGTGGTTAATGCGGTTGGGGG + Intergenic
1143509567 17:7388046-7388068 TGGGTGGTTCATGTGTCAGGTGG - Intronic
1147398498 17:40163998-40164020 GGGGTGGTTTCTGGGACTGGAGG - Exonic
1150041237 17:61863485-61863507 TGTGTGGTTGAGGGGTCTGGTGG - Exonic
1150631231 17:66881814-66881836 GGGGTGGAAAATGGGCCTGGAGG + Intronic
1151782620 17:76257662-76257684 TGGGTGGTCGATGGGACTGGGGG + Intergenic
1152645770 17:81467898-81467920 CAGGTGGTTAATGGGGGCGGGGG + Intergenic
1155510634 18:26573002-26573024 GGGGTGGTTATTGAGTCTGTAGG - Intronic
1156455904 18:37293969-37293991 CAGGTGGTTGGTGGGTCAGGTGG - Intronic
1157942924 18:51948941-51948963 CAGGTGGTGAATTGGTCTAGGGG + Intergenic
1160349126 18:78159588-78159610 GTGGTGGTTATCGGGTCTGGGGG - Intergenic
1162818194 19:13208531-13208553 CGGGTGGGCAAGGGGGCTGGGGG + Intronic
1167294277 19:48640201-48640223 CCTGTGGTCAATGTGTCTGGAGG - Exonic
925743774 2:7028128-7028150 CAGGAGGTTACTGGCTCTGGGGG + Intronic
926698320 2:15785687-15785709 CTGGTGGGAAATGGGTTTGGGGG + Intergenic
928175847 2:29033883-29033905 CTGGTGGTTAAAGGATCTGCTGG - Intronic
928719251 2:34100309-34100331 AGAGTGGTTTCTGGGTCTGGAGG + Intergenic
934476876 2:94599540-94599562 CGGGTGGTTAATGGGTCTGGTGG - Intronic
935689069 2:105714183-105714205 AGGGTGGTAGGTGGGTCTGGGGG - Intergenic
943320478 2:186437131-186437153 CTGGGGGTTTATGGGTCTGTGGG + Intergenic
943947814 2:194090406-194090428 TGGGTGGTCAATGGGACCGGGGG + Intergenic
1171973812 20:31581351-31581373 CGGCTGGGAAGTGGGTCTGGTGG - Intergenic
1178476893 21:32944883-32944905 AGGGTGGGCAAGGGGTCTGGAGG + Intergenic
1179123294 21:38568832-38568854 CGGGTGCTTGATGAGGCTGGGGG - Intronic
950001816 3:9662481-9662503 TGGGTGGTTACTGGGTGTTGTGG + Intronic
951909214 3:27731523-27731545 CGGGATGTTAATGGGGCTGACGG - Intergenic
954216834 3:49129360-49129382 TGGGTGGTGATGGGGTCTGGAGG - Intronic
954613673 3:51959000-51959022 AGGGTGGGTAGGGGGTCTGGGGG - Intronic
954822268 3:53340561-53340583 CGGGGGGGTAATTGGTCTTGGGG - Intronic
961653340 3:128428368-128428390 CGTGAGGCTCATGGGTCTGGTGG - Intergenic
967098170 3:186194156-186194178 CGGGTGGTTGGTTGGTTTGGTGG + Intronic
972249162 4:37281032-37281054 AGGGTGGGGAGTGGGTCTGGAGG + Intronic
974590535 4:63942896-63942918 TGGGTGGTTGATGGGACTGGGGG + Intergenic
975308591 4:72877390-72877412 TGGGTGGTTGATGGGGCAGGCGG - Intergenic
976217759 4:82731014-82731036 ATGGTTGTTGATGGGTCTGGGGG - Intronic
978350140 4:107812710-107812732 AGGGTGGAGAATGGATCTGGAGG - Intergenic
983134989 4:164068700-164068722 TGGGTGGTCAATGGGACTGGGGG - Intronic
992488338 5:77216850-77216872 AGGGTGGAGAGTGGGTCTGGAGG + Intronic
994651525 5:102535009-102535031 CGGGTGGTTAGTGGGTATCTGGG + Intergenic
994980881 5:106874565-106874587 CTGGGGGTTTATGGGTCTGTGGG - Intergenic
996405363 5:123098450-123098472 CGGGTTATTAATGGGCCTGGAGG - Intronic
996900299 5:128537103-128537125 CGGGTGGTTAGGGGGTCCAGGGG - Intronic
1001021575 5:168187394-168187416 CGGGTGGTAAATGGGTTGGAGGG + Intronic
1001584731 5:172826175-172826197 GGAGTGGGGAATGGGTCTGGAGG - Intergenic
1002817754 6:694928-694950 TGGGTGGTCGATGGGACTGGGGG - Intergenic
1003234748 6:4285416-4285438 AGGGTGGTTAAAGAATCTGGAGG + Intergenic
1006128005 6:31852362-31852384 TGGGAGGTTGATGGGACTGGGGG - Intergenic
1006393282 6:33771452-33771474 GGGGTGGTTAATGTTTCTGGAGG + Exonic
1009530368 6:64804448-64804470 CAGATGGTTAATGAGTTTGGTGG - Intronic
1018416806 6:163608671-163608693 CGCGTGACTAGTGGGTCTGGTGG + Intergenic
1021988197 7:26117556-26117578 TTGGTTGTGAATGGGTCTGGAGG - Intergenic
1022797317 7:33742438-33742460 CAGGAGGTTAATGGGTTTGGTGG + Intergenic
1023278577 7:38546866-38546888 AGGGTGGAGAATGGATCTGGAGG - Intronic
1023942701 7:44780207-44780229 CGGGTGGTGAATGGGGCTGTAGG + Intergenic
1036658914 8:10695315-10695337 CGGGAGGGTACTGGGTTTGGAGG - Intronic
1048748654 8:137645567-137645589 CGGGTGGTTGATGAGTCTGGAGG + Intergenic
1048911718 8:139141535-139141557 TGGGTGGGAAATGGGTCTGTTGG + Intergenic
1049421588 8:142518982-142519004 CGGGAGGTCAATGTGGCTGGTGG + Intronic
1050681507 9:8117112-8117134 AGGCTGGTTAATGAATCTGGAGG - Intergenic
1052853151 9:33390366-33390388 TGGGTGGTTAATGGGTCTGGTGG + Intronic
1053681189 9:40486540-40486562 CGGGTGGTTAATGGGTCTGGTGG + Intergenic
1053931178 9:43114864-43114886 CGGGTGGTTAATGGGTCTGGTGG + Intergenic
1054282525 9:63138394-63138416 CGGGTGGTTAATGGGTCTGGTGG - Intergenic
1054294276 9:63322055-63322077 CGGGTGGTTAACGGGTCTGGTGG + Intergenic
1054392298 9:64626544-64626566 CGGGTGGTTAATGGGTCTGGTGG + Intergenic
1054426946 9:65131755-65131777 CGGGTGGTTAATGGGTCTGGTGG + Intergenic
1054503429 9:65889785-65889807 CGGGTGGTTAATGGGTCTGGTGG - Intronic
1055925678 9:81507715-81507737 TGGGTGGTCAATGGGACTGGGGG - Intergenic
1056313699 9:85368575-85368597 CTGCTGGTTGATGGGCCTGGGGG - Intergenic
1057551531 9:96054129-96054151 CAGGTGGACAGTGGGTCTGGGGG + Intergenic
1187734055 X:22286341-22286363 GGGGTGTTTAATGGTCCTGGAGG - Intergenic