ID: 1054282528

View in Genome Browser
Species Human (GRCh38)
Location 9:63138403-63138425
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282528_1054282538 1 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data
1054282528_1054282536 -3 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282528_1054282543 17 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282528_1054282544 20 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG No data
1054282528_1054282535 -4 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282528_1054282539 2 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282528_1054282532 -9 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282532 9:63138417-63138439 TCTATCCACATATCACCCCTTGG No data
1054282528_1054282537 0 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282528_1054282533 -5 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282528 Original CRISPR GTGGATAGACGGGTGGTTAA TGG (reversed) Intergenic
No off target data available for this crispr