ID: 1054282531

View in Genome Browser
Species Human (GRCh38)
Location 9:63138414-63138436
Sequence AGGGGTGATATGTGGATAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282531_1054282544 9 Left 1054282531 9:63138414-63138436 CCGTCTATCCACATATCACCCCT No data
Right 1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG No data
1054282531_1054282543 6 Left 1054282531 9:63138414-63138436 CCGTCTATCCACATATCACCCCT No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282531_1054282539 -9 Left 1054282531 9:63138414-63138436 CCGTCTATCCACATATCACCCCT No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282531_1054282538 -10 Left 1054282531 9:63138414-63138436 CCGTCTATCCACATATCACCCCT No data
Right 1054282538 9:63138427-63138449 TATCACCCCTTGGCTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282531 Original CRISPR AGGGGTGATATGTGGATAGA CGG (reversed) Intergenic
No off target data available for this crispr