ID: 1054282533

View in Genome Browser
Species Human (GRCh38)
Location 9:63138421-63138443
Sequence TCCACATATCACCCCTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 9, 1: 0, 2: 0, 3: 2, 4: 80}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282525_1054282533 4 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282526_1054282533 1 Left 1054282526 9:63138397-63138419 CCAGACCCATTAACCACCCGTCT No data
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282523_1054282533 12 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282522_1054282533 20 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282524_1054282533 11 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282521_1054282533 21 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282527_1054282533 -4 Left 1054282527 9:63138402-63138424 CCCATTAACCACCCGTCTATCCA No data
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80
1054282528_1054282533 -5 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG 0: 9
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282533 Original CRISPR TCCACATATCACCCCTTGGC TGG Intergenic
901170988 1:7257057-7257079 TCCACATACCATCGCATGGCGGG + Intronic
902220600 1:14962129-14962151 CCCACATCACACCCCTTGTCAGG - Intronic
903261038 1:22132024-22132046 TCCACAGGCGACCCCTTGGCTGG - Intronic
905211148 1:36374949-36374971 TCCACATGGGACCCCATGGCAGG - Intronic
906253547 1:44330273-44330295 CCCTCAGATCAGCCCTTGGCTGG + Intronic
906278989 1:44540404-44540426 ACCACACATCACCCCCTGACAGG + Intronic
915453169 1:156020815-156020837 TCCGCGCATCACCCCGTGGCTGG - Intronic
919914170 1:202129836-202129858 TCCACAAAGCCCCCCTTGGAGGG + Exonic
921003555 1:211069173-211069195 TCCTCCCCTCACCCCTTGGCAGG - Intronic
921030889 1:211334360-211334382 TCCACATAAAACACATTGGCTGG + Intronic
921560591 1:216653758-216653780 TACACATATTACCCATTGGATGG + Intronic
1063225493 10:4011738-4011760 TCCACCAACCACCCCTTGCCAGG - Intergenic
1064101969 10:12471714-12471736 TCAACATATCTCTCCTTAGCAGG - Intronic
1071110550 10:82150222-82150244 TTTACATATCACCCATTTGCAGG + Intronic
1080810768 11:35702056-35702078 ACCCCATATAACCCCTTGGGTGG - Intronic
1092075716 12:5671688-5671710 TCCCCAAATAACCCCTTGGAGGG + Intronic
1092173721 12:6389212-6389234 TCCCCAGATAACCCCATGGCTGG - Intronic
1093269330 12:17039579-17039601 TCCACATACCACCACTTTTCTGG - Intergenic
1107693419 13:42975692-42975714 GCCACAAATCACACCTTAGCTGG + Intronic
1110764019 13:79262483-79262505 TCCACATATAACCCCTTCTATGG - Intergenic
1111670202 13:91320467-91320489 TTCACACATCTCACCTTGGCAGG + Intergenic
1113529696 13:111013456-111013478 ACCACAGATCACCCTTTGGGAGG + Intergenic
1119696799 14:76719753-76719775 TCCACAGGTCACTCCTGGGCTGG - Intergenic
1123586455 15:21764817-21764839 TCCCCAAATAACCCCTTGGAGGG - Intergenic
1123623094 15:22207397-22207419 TCCCCAAATAACCCCTTGGAGGG - Intergenic
1123977886 15:25570125-25570147 TCCACCTTTCTCCCCATGGCAGG + Intergenic
1124715840 15:32060941-32060963 TCTGCATATCAGCCCTTGGTGGG - Intronic
1125422653 15:39519940-39519962 TCCACCTGTCACCACTGGGCAGG + Intergenic
1132234543 15:100209388-100209410 TCCATAAATCACTCCCTGGCAGG + Intronic
1132403296 15:101527066-101527088 CCCACTTCTCACCCCTTGCCCGG - Intergenic
1138751734 16:59430657-59430679 CCCACACCCCACCCCTTGGCAGG - Intergenic
1141030855 16:80587102-80587124 TACACATCTCTTCCCTTGGCTGG - Intergenic
1141095564 16:81160447-81160469 TCCTCATGACAACCCTTGGCAGG - Intergenic
1143349802 17:6279430-6279452 TGCACTTATCACCCCTGGGAAGG + Intergenic
1147559574 17:41500571-41500593 TCCCCAGATCACCCCTTCACTGG + Intergenic
1152633305 17:81420335-81420357 CCCACACAGCACCCCTGGGCCGG + Intronic
1157846359 18:51007233-51007255 ACCACATATCATCTCTTGACCGG - Intronic
1162752501 19:12837524-12837546 TCCACAGATCCTCCCATGGCTGG + Intronic
1166114321 19:40643793-40643815 CCCACATACCATGCCTTGGCTGG + Intergenic
1168098264 19:54127770-54127792 TCCCCATCTCACCCCTGGTCTGG + Intronic
930328741 2:49955378-49955400 TCCACATTATACCCCATGGCTGG + Intronic
934476884 2:94599567-94599589 TCCACATATCACCCCTTGGCTGG + Intronic
935019191 2:99214028-99214050 TCCACATAACACCTGTTGGTTGG + Intronic
938738468 2:134208058-134208080 TTCACTTATCATCCCTAGGCAGG - Intronic
940973206 2:159915963-159915985 TCCCAATATCACCTCTTGCCTGG - Intergenic
944142741 2:196475199-196475221 TCCTCATTTCTGCCCTTGGCTGG - Intronic
947835744 2:233174015-233174037 TCCACATCTCATCCCATGGAAGG + Intronic
948462020 2:238134367-238134389 GCCACATCTCACCCCTCGCCTGG - Intergenic
1169289993 20:4341345-4341367 TCCACTTATGTCCCATTGGCTGG + Intergenic
1171348286 20:24483305-24483327 TCCACATGTAACCCCATGCCTGG - Intronic
1175163857 20:57029322-57029344 TCCACATGTCATCTCTTGGGAGG - Intergenic
1178242763 21:30921779-30921801 TCCACATATCTTCTCTTGGGAGG - Intergenic
1180920753 22:19520305-19520327 TCCTCATAGCACCCCTTGACTGG - Intronic
1181077855 22:20393582-20393604 TCCACAGTTCACCCCTGGGGCGG - Intergenic
1182119855 22:27779584-27779606 TCCACACTGCACCCCTGGGCAGG + Intronic
955876490 3:63495298-63495320 TCCACAATCCACCCCTTGTCAGG - Intronic
957532755 3:81461299-81461321 TAAACATCTCACCCCTTTGCAGG + Intergenic
967174645 3:186852257-186852279 TCTCCATCTCACTCCTTGGCTGG - Intronic
977359221 4:95981954-95981976 TCCACACAGTCCCCCTTGGCAGG + Intergenic
981565651 4:146098791-146098813 TCCACATGGCACTCCTTGGAAGG + Intergenic
992659701 5:78946126-78946148 TCTACATATAACTCATTGGCAGG + Intronic
994700953 5:103134699-103134721 TCCACATACCATCTCTTGGTAGG + Intronic
998439305 5:142143267-142143289 TTCACATGGCACCCTTTGGCTGG + Intronic
1002925957 6:1605753-1605775 CCCACCTATCGCCCCTTGGCAGG - Intergenic
1010465712 6:76165527-76165549 TCCACATAGCTCCCCATGTCAGG - Intergenic
1016604709 6:145907077-145907099 TCCACATATCAACACTTTTCTGG + Intronic
1018696133 6:166393349-166393371 TGCACTTATCAGCCCTTGGGTGG + Intergenic
1020628220 7:10608926-10608948 ACCATATCTCACCTCTTGGCAGG + Intergenic
1024210500 7:47199181-47199203 TCCAAATATCACCCCATTGGGGG + Intergenic
1029288975 7:99487397-99487419 TCCACATATGACACATTGGTAGG - Exonic
1033846575 7:145440150-145440172 TCCTCATAACACCCCCTTGCAGG - Intergenic
1034789211 7:153952582-153952604 TCCACATTTCACCCCATGTGGGG - Intronic
1036107099 8:5853154-5853176 ACTACATATCACTCCTTGACTGG - Intergenic
1036967664 8:13318778-13318800 TCTACATGTCAGTCCTTGGCCGG + Intronic
1045404609 8:101853327-101853349 TCAACATTTCTCCCTTTGGCTGG + Intronic
1048204440 8:132404035-132404057 TCCACAGACCAGCCCTTGCCTGG + Intronic
1048942936 8:139418277-139418299 GCCAGATATCACCCCTTTCCTGG + Intergenic
1052853143 9:33390339-33390361 TCCACATATCACCCCTTGGCTGG - Intronic
1053425281 9:38006158-38006180 TCCACACAGCACCCACTGGCTGG + Intronic
1053681181 9:40486513-40486535 TCCACATATCACCCCTTGGCTGG - Intergenic
1053931170 9:43114837-43114859 TCCACATATCACCCCTTGGCTGG - Intergenic
1054282533 9:63138421-63138443 TCCACATATCACCCCTTGGCTGG + Intergenic
1054294268 9:63322028-63322050 TCCACATATCACCCCTTGGCTGG - Intergenic
1054392290 9:64626517-64626539 TCCACATATCACCCCTTGGCTGG - Intergenic
1054426938 9:65131728-65131750 TCCACATATCACCCCTTGGCTGG - Intergenic
1054503437 9:65889812-65889834 TCCACATATCACCCCTTGGCTGG + Intronic
1054876152 9:70098264-70098286 CCCACTTACCACCCTTTGGCAGG + Intronic
1058679922 9:107431827-107431849 TTCACATCTCTCCCTTTGGCTGG - Intergenic
1192561937 X:72132840-72132862 TCCACTGAGCACCTCTTGGCAGG - Intergenic
1195750285 X:108157295-108157317 TCCCCACACCAACCCTTGGCAGG - Intronic
1201404478 Y:13635900-13635922 TCCACATAATATACCTTGGCTGG - Intergenic