ID: 1054282534

View in Genome Browser
Species Human (GRCh38)
Location 9:63138422-63138444
Sequence CCCAGCCAAGGGGTGATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 9, 1: 0, 2: 1, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282534_1054282544 1 Left 1054282534 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 1
3: 15
4: 197
Right 1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG No data
1054282534_1054282543 -2 Left 1054282534 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 1
3: 15
4: 197
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282534 Original CRISPR CCCAGCCAAGGGGTGATATG TGG (reversed) Intergenic
900735706 1:4298222-4298244 CCCAGCCAAGGGGCAGTAGGAGG + Intergenic
901923824 1:12553562-12553584 CCCAGCCAAGGGGAGAAAAATGG - Intergenic
902179824 1:14679405-14679427 CCTGGCCCTGGGGTGATATGGGG + Intronic
902220599 1:14962128-14962150 CCCTGACAAGGGGTGTGATGTGG + Intronic
902772697 1:18654923-18654945 GCCACCCCAGGGGTGATAGGAGG - Intronic
903261037 1:22132023-22132045 CCCAGCCAAGGGGTCGCCTGTGG + Intronic
905515907 1:38561847-38561869 CCCAGCGAGGGGGAGAGATGAGG - Intergenic
906253548 1:44330274-44330296 TCCAGCCAAGGGCTGATCTGAGG - Intronic
909239208 1:73191186-73191208 TACAGCAAAAGGGTGATATGAGG - Intergenic
910635767 1:89405659-89405681 CCCAGCCAAGGGGAGCCCTGAGG - Intergenic
911530644 1:99039468-99039490 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
915453168 1:156020814-156020836 CCCAGCCACGGGGTGATGCGCGG + Intronic
915663562 1:157424189-157424211 CCCAGCCAAGGGAAGGTGTGAGG + Intergenic
916232316 1:162552574-162552596 ACAGGCCAAGGGGAGATATGAGG + Intergenic
919492202 1:198218668-198218690 CCCAACAAAGGACTGATATGCGG + Intronic
921003554 1:211069172-211069194 CCCTGCCAAGGGGTGAGGGGAGG + Intronic
921030890 1:211334361-211334383 CCCAGCCAATGTGTTTTATGTGG - Intronic
921187041 1:212679052-212679074 CACAGCCCTGGGGTGAAATGGGG + Intergenic
921701633 1:218275009-218275031 CACGGCCAAGGGGTTATATATGG - Intergenic
923781668 1:237030658-237030680 CACAGCCTAGTGGTGATATTTGG + Intergenic
924134309 1:240947641-240947663 CTCAGCCACAGGATGATATGAGG - Intronic
1063587019 10:7361798-7361820 ACAAGCCAAGGGGTGTTATTTGG + Intronic
1063666419 10:8063274-8063296 CCCAGCCAGGGGGTGCAAGGGGG - Intronic
1066263071 10:33747966-33747988 CACAGCCAGGGGGTGAAGTGTGG + Intergenic
1068096549 10:52499083-52499105 CCCAGCTCTGGGGTGATATTGGG + Intergenic
1070213106 10:74347347-74347369 CCCAGCCAAGGGAAGCCATGAGG + Intronic
1070999670 10:80817790-80817812 CGCAGCCAAGGGAGGCTATGAGG + Intergenic
1075229916 10:120667150-120667172 CACAGCCAGCGGGTTATATGCGG - Intergenic
1077550557 11:3198218-3198240 CCCAGCCCAGGGGTCCTCTGGGG + Intergenic
1077713593 11:4559334-4559356 CCCAGCCAAGGGAAGCTATGAGG + Intergenic
1079384371 11:19965930-19965952 CCCAGCCCAGGAGTGAGACGTGG - Intronic
1080810767 11:35702055-35702077 GCCACCCAAGGGGTTATATGGGG + Intronic
1083535105 11:63460062-63460084 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1089175183 11:116543562-116543584 CCCAGTGATGGGGTGAGATGGGG + Intergenic
1090307426 11:125703359-125703381 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1090382786 11:126338617-126338639 CCCACCCAAGAGGTAAAATGGGG + Intronic
1090688807 11:129155989-129156011 CCTAGCCAAGGGAAGATGTGAGG + Intronic
1090725156 11:129518326-129518348 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1092173720 12:6389211-6389233 GCCAGCCATGGGGTTATCTGGGG + Intronic
1092398018 12:8145859-8145881 CCCAGCCAAGGGAGGAGGTGAGG + Intronic
1092629012 12:10358756-10358778 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1093269329 12:17039578-17039600 CCCAGAAAAGTGGTGGTATGTGG + Intergenic
1093664538 12:21795780-21795802 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1093884496 12:24444003-24444025 CCTACCCAAGAGGTGAGATGTGG + Intergenic
1095930869 12:47624069-47624091 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1097412067 12:59267835-59267857 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1100987894 12:100221912-100221934 CCCAGCCAAGTTGTGTTTTGGGG + Intronic
1101421728 12:104556308-104556330 CCCAGCTAAGAGATTATATGAGG + Intronic
1106336648 13:28789395-28789417 CCCAGCCAAGGGAAGTTGTGAGG - Intergenic
1106650802 13:31688143-31688165 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1107666174 13:42693462-42693484 CCCAGCTATGGGCTGGTATGGGG + Intergenic
1107693420 13:42975693-42975715 CCCAGCTAAGGTGTGATTTGTGG - Intronic
1110337208 13:74346497-74346519 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1111186301 13:84740628-84740650 CCTGGCCAAGGTGTGATATTAGG - Intergenic
1112913947 13:104523009-104523031 CCCAGCCAAGGGAGGCCATGAGG - Intergenic
1112990045 13:105502286-105502308 CCCAGCCAAGTGGTACTTTGAGG + Intergenic
1114567110 14:23640742-23640764 CCCAGCCAAGGGCAGATAGAAGG - Intronic
1115339020 14:32272641-32272663 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1115691093 14:35844413-35844435 CCTAGCCAAGGGGAGCCATGAGG - Intronic
1116781703 14:49244016-49244038 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1119903318 14:78280599-78280621 CCCAGCCAAGGGGGTGAATGGGG + Intronic
1124474739 15:30023112-30023134 CCCAGCCAAGGGAAGCTGTGAGG - Intergenic
1125278617 15:38020511-38020533 ACCACCCAAGGGGAGATAAGAGG + Intergenic
1125330125 15:38574103-38574125 CTCACCCAAGGGGTGAGAAGAGG - Intergenic
1125503976 15:40256335-40256357 CTCAGCCAAGGGGTCAGGTGAGG + Intronic
1126219686 15:46197918-46197940 CCCAGCCAAGGGAGGTGATGAGG - Intergenic
1127029957 15:54850947-54850969 CCCAGCCAAGGGAAGACATGAGG + Intergenic
1127041673 15:54983941-54983963 CCCAGCCATGGGGAGATCTGGGG - Intergenic
1128613430 15:69091403-69091425 CCCAGCCCAGGGGGGATTGGAGG - Intergenic
1128712832 15:69884985-69885007 GCAAGCCCAGGGGTGAAATGGGG + Intergenic
1129177090 15:73847984-73848006 CCCAGGCAAGGGGGGAAGTGGGG + Intergenic
1129909510 15:79214583-79214605 CTCAGCCAAGGGGTGTGATCTGG - Intergenic
1131051291 15:89349721-89349743 ACCAGCCAAGGTGGGACATGGGG + Intergenic
1132138030 15:99363299-99363321 CCCAGGCAAGGGGTGGCAGGTGG + Intronic
1132325350 15:100964219-100964241 CCCAGCCCCGGGGTGATCTGCGG - Intronic
1132403295 15:101527065-101527087 CCCGGGCAAGGGGTGAGAAGTGG + Intergenic
1133062306 16:3182948-3182970 CCCAGCCCAGGGCTGAGAGGCGG - Intergenic
1135724600 16:24844922-24844944 CCCAGTGAAGGAGTGAGATGGGG + Intergenic
1141095563 16:81160446-81160468 CCCTGCCAAGGGTTGTCATGAGG + Intergenic
1141399174 16:83732317-83732339 ACCAGCCAAGGGGAGAGGTGAGG + Intronic
1144371715 17:14597696-14597718 CCTAGCCAAGGGATGCTGTGAGG + Intergenic
1146638879 17:34525583-34525605 CCCAGGCAAGGGGAGATCTAGGG + Intergenic
1147558764 17:41496485-41496507 CCCAGCCAAGGGAAGCTCTGGGG - Intergenic
1147559575 17:41500572-41500594 GCCAGTGAAGGGGTGATCTGGGG - Intergenic
1147930697 17:43978795-43978817 CCCAGCCAAGGGGTGGGAGTGGG - Intronic
1149010505 17:51851677-51851699 ACTAGACAAAGGGTGATATGTGG - Intronic
1152633306 17:81420336-81420358 CCCGGCCCAGGGGTGCTGTGTGG - Intronic
1153119129 18:1700182-1700204 CCTAGCCAAGGGGAGCCATGAGG + Intergenic
1155384865 18:25266664-25266686 CCTAGCCAAGGGAAGATGTGAGG + Intronic
1158835114 18:61322486-61322508 CCCAGCCAGGGGGAGACAGGAGG - Intergenic
1162433696 19:10644212-10644234 CCCACCCAAGGGATGATGTCAGG + Exonic
1166114322 19:40643794-40643816 CCCAGCCAAGGCATGGTATGTGG - Intergenic
1168098265 19:54127771-54127793 CCCAGACCAGGGGTGAGATGGGG - Intronic
926859801 2:17297206-17297228 CTTAGCCAAAGGGTGATCTGTGG - Intergenic
927182733 2:20458519-20458541 CCTAGCCAAGGGAAGCTATGAGG + Intergenic
930299784 2:49600890-49600912 CCCAGCAAATGTATGATATGTGG - Intergenic
932277234 2:70460740-70460762 CACAGCCAAGGGATGTTGTGAGG - Intronic
933317812 2:80736627-80736649 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
934476885 2:94599568-94599590 CCCAGCCAAGGGGTGATATGTGG - Intronic
936900052 2:117472409-117472431 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
937562657 2:123244688-123244710 CCCAGCCAAGGGAAGATGTGAGG + Intergenic
937799179 2:126061164-126061186 CCCAGCCAAGGGTGGAAGTGAGG - Intergenic
938322577 2:130374885-130374907 CCCTGCCAAGGGGTGGGGTGGGG - Exonic
940973205 2:159915962-159915984 TCCAGGCAAGAGGTGATATTGGG + Intergenic
942275826 2:174322881-174322903 CCCAGGCAAGGCTTGAAATGCGG - Intergenic
942534382 2:176948149-176948171 CCCAGCCAGGAGGGGAAATGGGG + Intergenic
943094821 2:183416533-183416555 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
944142740 2:196475198-196475220 TCCAGCCAAGGGCAGAAATGAGG + Intronic
944267839 2:197748162-197748184 CCCAGCCAAGGGAAGCCATGAGG + Intronic
947492056 2:230603553-230603575 CCTAGCCAAGGGAAGACATGAGG + Intergenic
948325772 2:237119514-237119536 CCCAGCCAAGGCGTTATTTTAGG + Intergenic
948462019 2:238134366-238134388 GCCAGGCGAGGGGTGAGATGTGG + Intergenic
1170155884 20:13269053-13269075 CCCAGCCAAAGGGTTACATCTGG - Intronic
1171387695 20:24781195-24781217 GCAAGCCAAGGGGTGAGGTGAGG - Intergenic
1172158510 20:32847181-32847203 CCCAGACATGACGTGATATGTGG - Intronic
1173855921 20:46250897-46250919 CCTAGCCAAGGACTGATAAGGGG - Intronic
1177517861 21:22177852-22177874 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1180320206 22:11313116-11313138 CCAAGCCAATGGGTCTTATGAGG - Intergenic
1180920752 22:19520304-19520326 CCCAGTCAAGGGGTGCTATGAGG + Intronic
1181305708 22:21916270-21916292 CCCAGGCAAGAGGTGACGTGAGG - Intergenic
1181323837 22:22029689-22029711 CCAGGCCAAGGGGTGAGGTGGGG + Intergenic
1182084280 22:27550835-27550857 GCCAGGAAAGGGGTGATTTGGGG + Intergenic
1184601927 22:45548890-45548912 CCCATCCAAGGGGTGTCCTGGGG + Intronic
1184654988 22:45936605-45936627 CCCAGCCAGGGGGTCCTTTGAGG - Intronic
955454035 3:59100735-59100757 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
955470315 3:59279754-59279776 TTCAGCCAAGGGGAGATGTGAGG + Intergenic
959120177 3:102223303-102223325 CCCAGCCAAGGGAAGCTGTGAGG - Intronic
960967359 3:123114513-123114535 CCCAGCCAGTGGGAGTTATGGGG + Intronic
962385165 3:134927057-134927079 CCCAGCCAGTGGGTGATGTCTGG + Intronic
962653803 3:137521985-137522007 CCAAGCCAAGAGGTGCAATGGGG - Intergenic
963401801 3:144807211-144807233 CCCAGCCAAGGGAAGTGATGAGG - Intergenic
965622012 3:170651374-170651396 CCCAGCCAAGGGAAGCCATGAGG - Intronic
966251014 3:177865638-177865660 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
967715520 3:192757971-192757993 CCCAGCCAAGGGAAGCCATGAGG + Intronic
968092865 3:195909260-195909282 CCCAGCCGGGGGGTGGTGTGGGG - Intronic
968639149 4:1702105-1702127 CCCTGGCAAGGGGTGACTTGAGG + Intronic
969121292 4:4913397-4913419 CCTAGCCAATGGGTCATCTGCGG + Intergenic
969275706 4:6134520-6134542 CCCAGCCTAGGGGTGGGAAGTGG - Intronic
970679309 4:18489093-18489115 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
973564664 4:52172066-52172088 CCCATCTAAGGGGAGATAAGTGG + Intergenic
973629040 4:52801867-52801889 CCCAGCCAAGGGAGGCCATGAGG + Intergenic
983485969 4:168331575-168331597 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
989800071 5:45526557-45526579 CCCAGCCAAAGAGTGTTCTGAGG + Intronic
992467799 5:77024383-77024405 ACAAGCCTAGGGGTGATGTGTGG + Intergenic
992615396 5:78542216-78542238 GCCAGCCCTGGGGTGATGTGAGG - Intronic
999688250 5:154122045-154122067 CCCAGCCAAGGGAAGCTGTGAGG + Intronic
1000547996 5:162625625-162625647 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1000820258 5:165973884-165973906 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1001700832 5:173705513-173705535 CCCAGCCACGGGGGGCTCTGGGG + Intergenic
1001956289 5:175850273-175850295 CCCAGCAAGGGGGTGGTATTTGG + Intronic
1002925956 6:1605752-1605774 TCCTGCCAAGGGGCGATAGGTGG + Intergenic
1005795701 6:29359706-29359728 CCCAGCCAAGGGAAGCTGTGAGG + Intronic
1006696340 6:35933544-35933566 CACAGCCAAGGGTTGATAAATGG + Intergenic
1006791103 6:36701823-36701845 CCCAGCCAAGGGGGTGCATGGGG + Intronic
1008259727 6:49350082-49350104 CCCAGCACAGGGGTGTGATGGGG + Intergenic
1010668376 6:78656044-78656066 CCCAGCCAAGGGAAGCTGTGAGG - Intergenic
1011304436 6:85910915-85910937 CCCAGCCAAGGGAGGAGGTGAGG + Intergenic
1012121340 6:95370935-95370957 CACAGCAAAGGGGTTATATGAGG - Intergenic
1012940033 6:105405545-105405567 CCCACCCAAGGGGCGAAGTGGGG + Intergenic
1013024975 6:106262773-106262795 CCCAGCCAAGGGAAGCCATGAGG + Intronic
1013833031 6:114297386-114297408 CCCAGCCAAGCGGTGTCCTGAGG + Intronic
1014129157 6:117811208-117811230 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1018797699 6:167200093-167200115 CCCAGCCAAGGGAAGCCATGTGG - Intergenic
1019203736 6:170341706-170341728 CCCAGCCAAGGGAAGCCATGAGG - Intronic
1019481196 7:1267578-1267600 CCCAGCCCAGGGCTGCTCTGGGG - Intergenic
1019496072 7:1341246-1341268 CCCAGCCATGGGGTGATCAGAGG - Intergenic
1020753478 7:12171083-12171105 CCTAGCCAAGGGATGCTATGAGG - Intergenic
1022501755 7:30886254-30886276 TCCAGCCCAGGGGTTCTATGAGG - Intronic
1024000978 7:45189293-45189315 CCCACCCATGGGGTGAGGTGGGG - Intergenic
1024094735 7:45974641-45974663 CCCAGGCAGGGGGAGCTATGTGG - Intergenic
1024495378 7:50040578-50040600 CCAAGCCAAGGGAAGACATGAGG + Intronic
1028998427 7:97127016-97127038 CCCAGCCAAGGGAAGCCATGAGG - Intronic
1031710937 7:125046215-125046237 CCTAGCCAAGGGAAGCTATGAGG + Intergenic
1035720004 8:1784743-1784765 CAGACCCAAGGGCTGATATGGGG + Exonic
1037234961 8:16709034-16709056 CCTAGCCAAGGTCTCATATGGGG - Intergenic
1037836854 8:22219780-22219802 CCCAGCCCCGGGGGGACATGAGG + Exonic
1041287243 8:56273461-56273483 CCCAGCCAAGGGAGGCTGTGAGG + Intergenic
1042110857 8:65379850-65379872 CCTAGCCAAGGGAAGACATGAGG + Intergenic
1043190978 8:77222789-77222811 CACAGCCAAGGAGTGTTAGGAGG - Intergenic
1044927945 8:97224865-97224887 CCAAGCCAAGGAGGCATATGTGG + Intergenic
1047938847 8:129807990-129808012 CAGTGCCAAGGGGAGATATGGGG + Intergenic
1048942937 8:139418278-139418300 TCCAGGAAAGGGGTGATATCTGG - Intergenic
1049738639 8:144223312-144223334 CCCAGCAGAGGGTGGATATGTGG + Intronic
1050963275 9:11765482-11765504 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1052853142 9:33390338-33390360 CCCAGCCAAGGGGTGATATGTGG + Intronic
1053681180 9:40486512-40486534 CCCAGCCAAGGGGTGATATGTGG + Intergenic
1053931169 9:43114836-43114858 CCCAGCCAAGGGGTGATATGTGG + Intergenic
1054282534 9:63138422-63138444 CCCAGCCAAGGGGTGATATGTGG - Intergenic
1054294267 9:63322027-63322049 CCCAGCCAAGGGGTGATATGTGG + Intergenic
1054392289 9:64626516-64626538 CCCAGCCAAGGGGTGATATGTGG + Intergenic
1054426937 9:65131727-65131749 CCCAGCCAAGGGGTGATATGTGG + Intergenic
1054503438 9:65889813-65889835 CCCAGCCAAGGGGTGATATGTGG - Intronic
1056938505 9:90936270-90936292 CTCAGCCAAGGAGTGACAAGAGG - Intergenic
1057863737 9:98662939-98662961 AGGAGCCAAGAGGTGATATGTGG + Intronic
1058801493 9:108548750-108548772 CCCAGGCCTGGGGTGAGATGTGG - Intergenic
1060820264 9:126657871-126657893 CCCAGCCTAGGAGTGAGTTGGGG + Intronic
1203368426 Un_KI270442v1:278870-278892 CCAAGCCAATGGGTCTTATGAGG - Intergenic
1186774925 X:12854974-12854996 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1187508728 X:19898643-19898665 CCCAACCAAGGGGGAATAAGAGG + Intergenic
1190341528 X:49300237-49300259 CCTAGCCAAGGGAAGTTATGAGG - Intronic
1190876461 X:54463729-54463751 CCAAGGCAAGGGGAGATATTAGG - Intronic
1190963789 X:55278326-55278348 CCCAGCCAAGGGAAGCCATGAGG - Intronic
1190966480 X:55305923-55305945 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1191867004 X:65712043-65712065 CCCAGCTCAAGGGTGATTTGAGG + Intronic
1192030646 X:67509118-67509140 CCCAGCCAACGGATGCCATGAGG + Intergenic
1192214913 X:69151276-69151298 CCAATCCAAATGGTGATATGAGG - Intergenic
1192971240 X:76233565-76233587 CCCAGCCAAGGGTAGCCATGAGG + Intergenic
1193071824 X:77314600-77314622 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1193404416 X:81083852-81083874 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1193514329 X:82445513-82445535 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1194631554 X:96291616-96291638 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1195642151 X:107187691-107187713 CCCAGCCAAGAGCTGATTTTTGG + Intronic
1195730345 X:107960140-107960162 CCCAGCCAAGGGAAGCCATGAGG - Intergenic
1195826161 X:109003582-109003604 CCCAGCCAAGGGATGCCATGAGG + Intergenic
1197413935 X:126151207-126151229 CACAGCCAAGGGAGGAGATGGGG - Intergenic
1197505936 X:127305733-127305755 CCCAGCCAAGGGAAGCCATGAGG + Intergenic
1201376682 Y:13330445-13330467 CTCAGCCAAGGGAAGCTATGAGG + Intronic
1201404477 Y:13635899-13635921 CCCAGCCAAGGTATATTATGTGG + Intergenic
1201931934 Y:19360240-19360262 CCCAGCCAAGGGGAGCTGTTAGG + Intergenic
1202263494 Y:22994046-22994068 CCCAGCCTACTGGTGATATTGGG + Intronic
1202416484 Y:24627787-24627809 CCCAGCCTACTGGTGATATTGGG + Intronic
1202454303 Y:25042299-25042321 CCCAGCCTACTGGTGATATTGGG - Intronic