ID: 1054282535

View in Genome Browser
Species Human (GRCh38)
Location 9:63138422-63138444
Sequence CCACATATCACCCCTTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 9, 1: 0, 2: 0, 3: 6, 4: 118}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282523_1054282535 13 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282522_1054282535 21 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282524_1054282535 12 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282527_1054282535 -3 Left 1054282527 9:63138402-63138424 CCCATTAACCACCCGTCTATCCA No data
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282526_1054282535 2 Left 1054282526 9:63138397-63138419 CCAGACCCATTAACCACCCGTCT No data
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282525_1054282535 5 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282528_1054282535 -4 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118
1054282521_1054282535 22 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282535 Original CRISPR CCACATATCACCCCTTGGCT GGG Intergenic
901923825 1:12553562-12553584 CCATTTTTCTCCCCTTGGCTGGG + Intergenic
902179823 1:14679405-14679427 CCCCATATCACCCCAGGGCCAGG - Intronic
902220598 1:14962128-14962150 CCACATCACACCCCTTGTCAGGG - Intronic
903261036 1:22132023-22132045 CCACAGGCGACCCCTTGGCTGGG - Intronic
915453167 1:156020814-156020836 CCGCGCATCACCCCGTGGCTGGG - Intronic
915543731 1:156584090-156584112 CTACATATCAGCCCTTGTGTTGG - Intronic
920240220 1:204541522-204541544 CTACATATCCCCCCTTGAGTTGG - Intronic
921030891 1:211334361-211334383 CCACATAAAACACATTGGCTGGG + Intronic
1068431489 10:56937754-56937776 ACACAGATAAACCCTTGGCTGGG - Intergenic
1076924204 10:133473621-133473643 CCACATCTTACCACTTAGCTTGG + Intergenic
1077713592 11:4559334-4559356 CCTCATAGCTTCCCTTGGCTGGG - Intergenic
1079384372 11:19965930-19965952 CCACGTCTCACTCCTGGGCTGGG + Intronic
1083613158 11:64014000-64014022 CCACAGATCACCCTGTGTCTTGG + Intronic
1085849100 11:80099105-80099127 CCACTTATCATCCCTTGCCCAGG - Intergenic
1086742033 11:90380088-90380110 CCAGATAAAACCCCCTGGCTTGG - Intergenic
1090525966 11:127537219-127537241 CCACAGCTCCTCCCTTGGCTTGG - Intergenic
1090688806 11:129155989-129156011 CCTCACATCTTCCCTTGGCTAGG - Intronic
1093269328 12:17039578-17039600 CCACATACCACCACTTTTCTGGG - Intergenic
1093884495 12:24444003-24444025 CCACATCTCACCTCTTGGGTAGG - Intergenic
1094479888 12:30873271-30873293 CAACTCATCACACCTTGGCTGGG + Intergenic
1095255171 12:40026373-40026395 CTAAATAGCACCCCTTTGCTTGG - Intronic
1102689747 12:114751032-114751054 CCATATATCACCCCCTGTCCAGG - Intergenic
1107102240 13:36606233-36606255 CCACTGCTCACCCCTGGGCTTGG + Intergenic
1107693421 13:42975693-42975715 CCACAAATCACACCTTAGCTGGG + Intronic
1111186302 13:84740628-84740650 CCTAATATCACACCTTGGCCAGG + Intergenic
1115691094 14:35844413-35844435 CCTCATGGCTCCCCTTGGCTAGG + Intronic
1118502194 14:66372073-66372095 CCACCTATCACCACCTGGCCAGG + Intergenic
1127029956 15:54850947-54850969 CCTCATGTCTTCCCTTGGCTGGG - Intergenic
1127041674 15:54983941-54983963 CCCCAGATCTCCCCATGGCTGGG + Intergenic
1128884478 15:71274059-71274081 CCACATCCCACACCTTGGCCAGG + Intronic
1131069312 15:89455334-89455356 CCACATATCACACATTTGTTTGG - Intergenic
1132138029 15:99363299-99363321 CCACCTGCCACCCCTTGCCTGGG - Intronic
1132325351 15:100964219-100964241 CCGCAGATCACCCCGGGGCTGGG + Intronic
1132403294 15:101527065-101527087 CCACTTCTCACCCCTTGCCCGGG - Intergenic
1133759000 16:8783122-8783144 GCATACATCACCACTTGGCTGGG - Exonic
1139950345 16:70665266-70665288 CCACATCTTACCCCTGGGCCTGG - Intronic
1140732576 16:77870110-77870132 CCACACATCAGCACTGGGCTTGG + Intronic
1141303941 16:82843452-82843474 CCACATATCTTCCCCTGGGTCGG - Intronic
1142594431 17:1022641-1022663 CCACACATCTTCCCATGGCTTGG + Intronic
1143975167 17:10824117-10824139 CCACATTTCGCCAGTTGGCTTGG + Exonic
1144371714 17:14597696-14597718 CCTCACAGCATCCCTTGGCTAGG - Intergenic
1148973480 17:51505655-51505677 CCACAGATGACCTCTTGCCTTGG + Intergenic
1149469796 17:56906985-56907007 GCACATATCACTCCTGGGCATGG - Intronic
1152633307 17:81420336-81420358 CCACACAGCACCCCTGGGCCGGG + Intronic
1153119128 18:1700182-1700204 CCTCATGGCTCCCCTTGGCTAGG - Intergenic
1155384864 18:25266664-25266686 CCTCACATCTTCCCTTGGCTAGG - Intronic
1160030950 18:75259465-75259487 ACACAAATCACCCCTTTGCCCGG + Intronic
1162823721 19:13238218-13238240 CCACATTTCAATCCATGGCTTGG + Intronic
1164145931 19:22512597-22512619 CAACATATTGCCCCTTGGGTTGG - Intronic
1164181441 19:22822398-22822420 CAACATATCTCCTATTGGCTAGG - Intergenic
1165704522 19:37966300-37966322 CCACACATGTCCCCTTGCCTCGG + Intronic
1166114323 19:40643794-40643816 CCACATACCATGCCTTGGCTGGG + Intergenic
1168098266 19:54127771-54127793 CCCCATCTCACCCCTGGTCTGGG + Intronic
926832545 2:16979304-16979326 TCAAATATTACCCCTTGGCCAGG + Intergenic
927182732 2:20458519-20458541 CCTCATAGCTTCCCTTGGCTAGG - Intergenic
930299785 2:49600890-49600912 CCACATATCATACATTTGCTGGG + Intergenic
934476886 2:94599568-94599590 CCACATATCACCCCTTGGCTGGG + Intronic
935102775 2:100012394-100012416 CCACATATCATTTCATGGCTAGG + Intronic
937562656 2:123244688-123244710 CCTCACATCTTCCCTTGGCTGGG - Intergenic
947492055 2:230603553-230603575 CCTCATGTCTTCCCTTGGCTAGG - Intergenic
1168807784 20:682775-682797 CTACATATCACCCCTATCCTGGG - Intergenic
1168817802 20:752452-752474 GCACAAAGCACTCCTTGGCTGGG - Intergenic
1169172148 20:3473477-3473499 CCACAGATCTCCACTTGGCCTGG - Intronic
1170155885 20:13269053-13269075 CCAGATGTAACCCTTTGGCTGGG + Intronic
1172158511 20:32847181-32847203 CCACATATCACGTCATGTCTGGG + Intronic
1173855922 20:46250897-46250919 CCCCTTATCAGTCCTTGGCTAGG + Intronic
1177163152 21:17571070-17571092 CCAAATATCTCCCCTGGGGTCGG + Intronic
1180320207 22:11313116-11313138 CCTCATAAGACCCATTGGCTTGG + Intergenic
1180582089 22:16847561-16847583 ACACATTTTACCCCTTGGGTTGG + Intergenic
1180920751 22:19520304-19520326 CCTCATAGCACCCCTTGACTGGG - Intronic
1181323836 22:22029689-22029711 CCCCACCTCACCCCTTGGCCTGG - Intergenic
952099310 3:29993315-29993337 CCACATATAACCCGTTGACCAGG - Intronic
953765665 3:45739342-45739364 CCATTTAGCACCCTTTGGCTTGG + Intronic
955539724 3:59961639-59961661 CCACATGGCTTCCCTTGGCTAGG + Intronic
961816888 3:129555709-129555731 CCACAGAGCACCCCATGGCGCGG + Exonic
962385164 3:134927057-134927079 CCAGACATCACCCACTGGCTGGG - Intronic
962653804 3:137521985-137522007 CCCCATTGCACCTCTTGGCTTGG + Intergenic
962826185 3:139102498-139102520 CCACATACCACCCCTCCCCTTGG - Intronic
968183256 3:196612774-196612796 CCACACATAACTCCTTGGCAAGG - Intergenic
969121291 4:4913397-4913419 CCGCAGATGACCCATTGGCTAGG - Intergenic
969275707 4:6134520-6134542 CCACTTCCCACCCCTAGGCTGGG + Intronic
969676868 4:8619195-8619217 TCACCCATCACCCCGTGGCTGGG + Intronic
970561492 4:17285901-17285923 GCACATATCTTCCCTTGGCCTGG - Intergenic
973564663 4:52172066-52172088 CCACTTATCTCCCCTTAGATGGG - Intergenic
980090441 4:128437392-128437414 CCATCTGTCACCCCTTGTCTTGG + Intergenic
982344784 4:154345230-154345252 GCAACTATCACCCCTAGGCTGGG - Intronic
983903843 4:173165033-173165055 CCACACATGACCCCATGACTTGG + Intergenic
990745923 5:58959311-58959333 CCACATGGCTTCCCTTGGCTAGG + Intergenic
1001956288 5:175850273-175850295 CCAAATACCACCCCCTTGCTGGG - Intronic
1004342695 6:14821387-14821409 CCACACATCAGACCCTGGCTAGG - Intergenic
1006272705 6:32976455-32976477 CCACAGATCATACCTTGGCAAGG - Exonic
1009774061 6:68181808-68181830 CCACCTCTCACCGCTTGCCTTGG - Intergenic
1017551280 6:155510724-155510746 CTAAATATCACTCCTTTGCTAGG + Intergenic
1018797700 6:167200093-167200115 CCACATGGCTTCCCTTGGCTGGG + Intergenic
1019496073 7:1341246-1341268 CCTCTGATCACCCCATGGCTGGG + Intergenic
1020715991 7:11675181-11675203 CCACATGGCTTCCCTTGGCTAGG - Intronic
1020753479 7:12171083-12171105 CCTCATAGCATCCCTTGGCTAGG + Intergenic
1024058736 7:45682764-45682786 CCACCTTCCACACCTTGGCTTGG - Intronic
1024094736 7:45974641-45974663 CCACATAGCTCCCCCTGCCTGGG + Intergenic
1024495377 7:50040578-50040600 CCTCATGTCTTCCCTTGGCTTGG - Intronic
1030696222 7:112588213-112588235 CCACTTCTGCCCCCTTGGCTTGG - Intergenic
1031710936 7:125046215-125046237 CCTCATAGCTTCCCTTGGCTAGG - Intergenic
1032991372 7:137398248-137398270 TCATATATCCCCCCTTGCCTGGG - Intronic
1035386715 7:158477937-158477959 CCACACATCCACCCTTGGCCAGG + Intronic
1037234962 8:16709034-16709056 CCCCATATGAGACCTTGGCTAGG + Intergenic
1037737361 8:21578462-21578484 CTCCATATCACCCCTTCCCTAGG - Intergenic
1042110856 8:65379850-65379872 CCTCATGTCTTCCCTTGGCTAGG - Intergenic
1044927944 8:97224865-97224887 CCACATATGCCTCCTTGGCTTGG - Intergenic
1045404610 8:101853328-101853350 CAACATTTCTCCCTTTGGCTGGG + Intronic
1048689527 8:136945282-136945304 CCACCTCTCACTCCTTGCCTTGG + Intergenic
1049055440 8:140232908-140232930 GCACATGTCACGCTTTGGCTTGG - Intronic
1049738638 8:144223312-144223334 CCACATATCCACCCTCTGCTGGG - Intronic
1052853141 9:33390338-33390360 CCACATATCACCCCTTGGCTGGG - Intronic
1053681179 9:40486512-40486534 CCACATATCACCCCTTGGCTGGG - Intergenic
1053931168 9:43114836-43114858 CCACATATCACCCCTTGGCTGGG - Intergenic
1054282535 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG + Intergenic
1054294266 9:63322027-63322049 CCACATATCACCCCTTGGCTGGG - Intergenic
1054392288 9:64626516-64626538 CCACATATCACCCCTTGGCTGGG - Intergenic
1054426936 9:65131727-65131749 CCACATATCACCCCTTGGCTGGG - Intergenic
1054503439 9:65889813-65889835 CCACATATCACCCCTTGGCTGGG + Intronic
1056201430 9:84280560-84280582 CTACAGGTCACCCCTGGGCTGGG + Intronic
1058801494 9:108548750-108548772 CCACATCTCACCCCAGGCCTGGG + Intergenic
1203368427 Un_KI270442v1:278870-278892 CCTCATAAGACCCATTGGCTTGG + Intergenic
1190341529 X:49300237-49300259 CCTCATAACTTCCCTTGGCTAGG + Intronic
1190876462 X:54463729-54463751 CCTAATATCTCCCCTTGCCTTGG + Intronic
1191656799 X:63607260-63607282 CCATCTGTCACCCCTTCGCTTGG - Intergenic
1192214914 X:69151276-69151298 CCTCATATCACCATTTGGATTGG + Intergenic
1195642150 X:107187691-107187713 CCAAAAATCAGCTCTTGGCTGGG - Intronic
1195817477 X:108904120-108904142 CCATCTTTCACCCCTTGCCTTGG - Intergenic
1195826160 X:109003582-109003604 CCTCATGGCATCCCTTGGCTGGG - Intergenic
1197193186 X:123671579-123671601 CCACATAGCACCCCCAGGATTGG - Intronic
1200856006 Y:7939116-7939138 TCAAATATCTCCCCCTGGCTAGG + Intergenic
1201404476 Y:13635899-13635921 CCACATAATATACCTTGGCTGGG - Intergenic