ID: 1054282536

View in Genome Browser
Species Human (GRCh38)
Location 9:63138423-63138445
Sequence CACATATCACCCCTTGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 9, 1: 0, 2: 0, 3: 8, 4: 119}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282521_1054282536 23 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282529_1054282536 -10 Left 1054282529 9:63138410-63138432 CCACCCGTCTATCCACATATCAC No data
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282524_1054282536 13 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282522_1054282536 22 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282528_1054282536 -3 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282527_1054282536 -2 Left 1054282527 9:63138402-63138424 CCCATTAACCACCCGTCTATCCA No data
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282525_1054282536 6 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282526_1054282536 3 Left 1054282526 9:63138397-63138419 CCAGACCCATTAACCACCCGTCT No data
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119
1054282523_1054282536 14 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG 0: 9
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282536 Original CRISPR CACATATCACCCCTTGGCTG GGG Intergenic
901923826 1:12553563-12553585 CATTTTTCTCCCCTTGGCTGGGG + Intergenic
902106411 1:14039942-14039964 TGCATATCACCCTTAGGCTGGGG + Intergenic
904719754 1:32499219-32499241 CACATGGCACCCCTTGGGTCAGG + Intronic
915139499 1:153758429-153758451 CACTCATCACCCCTGAGCTGAGG - Intronic
915453166 1:156020813-156020835 CGCGCATCACCCCGTGGCTGGGG - Intronic
921701634 1:218275010-218275032 CATATATAACCCCTTGGCCGTGG + Intergenic
923238111 1:232054705-232054727 CCCACATCACCCCTTTGCCGAGG - Intergenic
923621386 1:235582251-235582273 CACCTGTCACCTCATGGCTGTGG + Intronic
1064272127 10:13875025-13875047 CAGATATCACTCCTTCCCTGGGG - Intronic
1068479775 10:57575881-57575903 TATATATCACACCTTGGCTATGG - Intergenic
1069701532 10:70430071-70430093 CACATTACACTCCTTGGCTGAGG - Intergenic
1070694101 10:78549020-78549042 CACACATCACCCCTCTCCTGTGG + Intergenic
1074650412 10:115516822-115516844 CATATATCACCCCTTTAGTGAGG + Intronic
1077713591 11:4559333-4559355 CTCATAGCTTCCCTTGGCTGGGG - Intergenic
1079404633 11:20133816-20133838 CACTTCTCACCCCATGGTTGGGG - Intergenic
1082906054 11:58309757-58309779 CTCCCATCACCCCATGGCTGTGG + Intergenic
1083050291 11:59770895-59770917 CCCACAACACCCCTTGGCTTTGG - Intronic
1084784474 11:71434205-71434227 CCCATGTCAGCCCTTTGCTGGGG - Intronic
1089742029 11:120591164-120591186 CACATCTCCTCCCTTGACTGTGG + Intronic
1090068450 11:123523946-123523968 CCCAAAGCAGCCCTTGGCTGTGG - Intergenic
1091695939 12:2628066-2628088 CACCTTTCACTCCTTGCCTGGGG - Intronic
1092550313 12:9491585-9491607 AACATATCACTCCTTCTCTGTGG + Intergenic
1094521499 12:31194786-31194808 AACATATCACTCCTTCTCTGTGG - Intergenic
1097456932 12:59811082-59811104 CACATGTCACCCCTGGGGTCAGG + Intergenic
1101718082 12:107328773-107328795 CAGATTTCACCACTGGGCTGCGG - Intronic
1102002386 12:109565533-109565555 CACCTATCACCACAGGGCTGCGG - Intronic
1102254244 12:111406679-111406701 CACAGATGAGCCCTTGGGTGTGG + Intronic
1108023407 13:46152895-46152917 CACATGGCACCCGATGGCTGAGG + Exonic
1112620119 13:101046593-101046615 TACCTATCAGCCCCTGGCTGGGG + Intergenic
1113238297 13:108307127-108307149 CACATGACACTCTTTGGCTGTGG - Exonic
1113321372 13:109235568-109235590 CACATTCCACCCCTTCCCTGAGG + Intergenic
1115262813 14:31470970-31470992 CAAATTTCACTTCTTGGCTGGGG - Intergenic
1119422273 14:74514494-74514516 CACAGATCAGCCTTTGGATGAGG + Intronic
1202890677 14_KI270722v1_random:154339-154361 CACATTTCAGCCATTGGATGTGG - Intergenic
1125330126 15:38574104-38574126 CTCTTCTCACCCCTTGGGTGAGG + Intergenic
1125800747 15:42444535-42444557 CACATCCCGCCCCCTGGCTGTGG + Intronic
1127029955 15:54850946-54850968 CTCATGTCTTCCCTTGGCTGGGG - Intergenic
1128664233 15:69526666-69526688 CACGTATCTCCCCAAGGCTGAGG - Intergenic
1129909511 15:79214584-79214606 CAGATCACACCCCTTGGCTGAGG + Intergenic
1132288060 15:100680078-100680100 CAAATAGCACCACTTTGCTGGGG - Intergenic
1132403293 15:101527064-101527086 CACTTCTCACCCCTTGCCCGGGG - Intergenic
1137012065 16:35331303-35331325 GACTTACCACCCCATGGCTGAGG + Intergenic
1142878395 17:2866243-2866265 CTCAGATCCCACCTTGGCTGTGG + Intronic
1145102276 17:20086979-20087001 CCCATATCCCCGCTTGGCTTAGG + Intronic
1147805872 17:43131041-43131063 CAGATATTAACCCTTTGCTGTGG + Intergenic
1148649179 17:49237399-49237421 CACGTATCACCCTGTGGCTCTGG + Intergenic
1149469795 17:56906984-56907006 CACATATCACTCCTGGGCATGGG - Intronic
1152633308 17:81420337-81420359 CACACAGCACCCCTGGGCCGGGG + Intronic
1152724486 17:81938439-81938461 CTCCTCTCACCCCTTGGCAGGGG - Intronic
1157197499 18:45631307-45631329 CACAGGTCACTCCTTGGCAGGGG + Intronic
1159440922 18:68478965-68478987 CACATGTGGCCCCTTGGCTGTGG - Intergenic
1160153091 18:76410077-76410099 CTCATAGCTCCCCATGGCTGGGG - Intronic
1163790195 19:19301949-19301971 CACACAGCAGCCCTTGGCCGGGG - Intronic
1168354987 19:55695267-55695289 TACATCTCTCCCCTTGGCGGGGG + Exonic
1168612604 19:57813446-57813468 CACAAACCACCCCTATGCTGAGG + Intronic
1168616199 19:57838975-57838997 CACAAACCACCCCTATGCTGAGG - Intronic
1202666099 1_KI270708v1_random:121177-121199 CACATTTCAGCCATTGGATGTGG - Intergenic
926326437 2:11788219-11788241 TCCATATCACCCCTAGGCAGAGG - Intronic
927651604 2:24916890-24916912 CACAAATGAGCCCTGGGCTGGGG + Intronic
927670642 2:25065996-25066018 CACATGTCACCACTTGGCTATGG + Intronic
930299786 2:49600891-49600913 CACATATCATACATTTGCTGGGG + Intergenic
932277235 2:70460741-70460763 CTCACAACATCCCTTGGCTGTGG + Intronic
932537127 2:72610734-72610756 TAAATTTCACCTCTTGGCTGTGG - Intronic
934214603 2:90019138-90019160 CAAATATTAACTCTTGGCTGGGG - Intergenic
934476887 2:94599569-94599591 CACATATCACCCCTTGGCTGGGG + Intronic
937562655 2:123244687-123244709 CTCACATCTTCCCTTGGCTGGGG - Intergenic
938119472 2:128623528-128623550 TGCATCCCACCCCTTGGCTGTGG + Intergenic
938379183 2:130827109-130827131 CACCTGTCCACCCTTGGCTGTGG + Intergenic
944285688 2:197947488-197947510 CAAATATCACCTCTTTGCAGAGG - Intronic
946297873 2:218800082-218800104 AACATAAAACCCCTTGGCTGCGG - Intronic
1171373712 20:24677802-24677824 CAAAAAACACCCCTGGGCTGTGG - Intergenic
1176900480 21:14435692-14435714 CACCTATTACACCTGGGCTGGGG + Intergenic
1177416784 21:20803662-20803684 CAGATATTCCCCCTTGTCTGTGG - Intergenic
1179496642 21:41775968-41775990 CACAAGTCAGCCCGTGGCTGTGG - Intergenic
1182031179 22:27160607-27160629 CACAGATCAGTGCTTGGCTGGGG - Intergenic
1183672792 22:39283029-39283051 CACTGGCCACCCCTTGGCTGGGG + Intergenic
949343585 3:3055046-3055068 GGCATATCACCCCTTAGCAGAGG - Intronic
955613727 3:60783984-60784006 GACATATCACCCCTGGCCTCAGG + Intronic
960399695 3:117181001-117181023 CACATATCAGCCTTTTGCGGGGG - Intergenic
964479164 3:157125051-157125073 CACATAACACCCCTTGTTTTTGG - Intergenic
967675202 3:192290030-192290052 CTAATATCTCCTCTTGGCTGGGG + Intronic
968976664 4:3825663-3825685 CACATCTGGCACCTTGGCTGGGG - Intergenic
969464830 4:7350152-7350174 CACAACCCACCCCATGGCTGCGG + Intronic
971591975 4:28480153-28480175 CATGTATCACCTCTTTGCTGAGG + Intergenic
977231057 4:94451941-94451963 CACTTGTCAGCCCTTGTCTGAGG + Exonic
978196596 4:105979579-105979601 CATATATCACCTCCTGGCTCTGG + Intronic
979576004 4:122293438-122293460 CACATAGCCTCCCTTGCCTGGGG - Intronic
982344783 4:154345229-154345251 CAACTATCACCCCTAGGCTGGGG - Intronic
987101111 5:14591812-14591834 CAGATATGACCCATGGGCTGTGG - Intronic
990329766 5:54714108-54714130 CAAAAGTCACCCCTTGGCAGAGG + Intergenic
999144544 5:149383630-149383652 AAAATAGCACCTCTTGGCTGGGG - Intronic
1000906886 5:166975055-166975077 TACATACCAGCCCTTGACTGTGG - Intergenic
1000925429 5:167187920-167187942 CACATTTCTCCCCCTGGCAGAGG + Intergenic
1004492429 6:16129315-16129337 CACATAACACAGCATGGCTGGGG - Exonic
1007313990 6:40969635-40969657 CACCTATCAACACTTTGCTGCGG - Intergenic
1008664136 6:53699186-53699208 CACAAATCACTGCCTGGCTGAGG + Intergenic
1019496074 7:1341247-1341269 CTCTGATCACCCCATGGCTGGGG + Intergenic
1020139234 7:5603694-5603716 CACAGAGCAGGCCTTGGCTGGGG - Intronic
1020628748 7:10615309-10615331 CACCTACCTCCTCTTGGCTGTGG + Intergenic
1020753480 7:12171084-12171106 CTCATAGCATCCCTTGGCTAGGG + Intergenic
1022965467 7:35467600-35467622 CAAATAGCACTACTTGGCTGCGG - Intergenic
1023091446 7:36621264-36621286 CATATATTAGCCCTGGGCTGAGG - Intronic
1023688543 7:42762796-42762818 CACATATATCCAGTTGGCTGTGG - Intergenic
1024094737 7:45974642-45974664 CACATAGCTCCCCCTGCCTGGGG + Intergenic
1026657844 7:72272856-72272878 GACATACCAACCCATGGCTGCGG - Intronic
1030307987 7:108038564-108038586 CACATGTGGCCCCTGGGCTGTGG - Intronic
1032991371 7:137398247-137398269 CATATATCCCCCCTTGCCTGGGG - Intronic
1039878541 8:41608453-41608475 CACTTATCCCCCCTTGGATATGG - Intronic
1041757664 8:61331933-61331955 GACAAATCATCCCTTGGATGGGG + Intronic
1043503626 8:80880735-80880757 CATATATCACCTTTTGGCTATGG - Intergenic
1043655664 8:82662607-82662629 CACAAATCAGCCCCTTGCTGAGG - Intergenic
1049055439 8:140232907-140232929 CACATGTCACGCTTTGGCTTGGG - Intronic
1051451998 9:17207335-17207357 CACAGAACACCCCTTGCCAGGGG + Intronic
1052853140 9:33390337-33390359 CACATATCACCCCTTGGCTGGGG - Intronic
1053681178 9:40486511-40486533 CACATATCACCCCTTGGCTGGGG - Intergenic
1053931167 9:43114835-43114857 CACATATCACCCCTTGGCTGGGG - Intergenic
1054282536 9:63138423-63138445 CACATATCACCCCTTGGCTGGGG + Intergenic
1054294265 9:63322026-63322048 CACATATCACCCCTTGGCTGGGG - Intergenic
1054392287 9:64626515-64626537 CACATATCACCCCTTGGCTGGGG - Intergenic
1054426935 9:65131726-65131748 CACATATCACCCCTTGGCTGGGG - Intergenic
1054503440 9:65889814-65889836 CACATATCACCCCTTGGCTGGGG + Intronic
1056938506 9:90936271-90936293 CTCTTGTCACTCCTTGGCTGAGG + Intergenic
1058433641 9:104941573-104941595 CACTTACCACCCCTTCACTGGGG + Intergenic
1059205432 9:112459989-112460011 CACATACCAGCCCTTGGCCATGG + Intronic
1061057424 9:128231945-128231967 CCCCTCTCAGCCCTTGGCTGAGG - Intronic
1186021499 X:5261457-5261479 CAATTATCATCCCTTGCCTGTGG + Intergenic
1189920292 X:45896763-45896785 CACCTAGCACCCCATGGCTCAGG + Intergenic
1191947685 X:66553698-66553720 CTCATGGCATCCCTTGGCTGGGG - Intergenic
1194911625 X:99651926-99651948 CACATATGACAATTTGGCTGTGG + Intergenic
1195826159 X:109003581-109003603 CTCATGGCATCCCTTGGCTGGGG - Intergenic
1195896311 X:109749335-109749357 CACTTCTCAGCCCTTGGGTGAGG + Intergenic
1197413937 X:126151208-126151230 CCCATCTCCTCCCTTGGCTGTGG + Intergenic
1201376681 Y:13330444-13330466 CTCATAGCTTCCCTTGGCTGAGG - Intronic
1202247060 Y:22830708-22830730 CACAGATCTCACCATGGCTGAGG + Intergenic
1202400049 Y:24464456-24464478 CACAGATCTCACCATGGCTGAGG + Intergenic
1202470732 Y:25205630-25205652 CACAGATCTCACCATGGCTGAGG - Intergenic