ID: 1054282537

View in Genome Browser
Species Human (GRCh38)
Location 9:63138426-63138448
Sequence ATATCACCCCTTGGCTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 9, 1: 0, 2: 1, 3: 8, 4: 176}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282528_1054282537 0 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282527_1054282537 1 Left 1054282527 9:63138402-63138424 CCCATTAACCACCCGTCTATCCA No data
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282522_1054282537 25 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282530_1054282537 -10 Left 1054282530 9:63138413-63138435 CCCGTCTATCCACATATCACCCC No data
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282523_1054282537 17 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282525_1054282537 9 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282529_1054282537 -7 Left 1054282529 9:63138410-63138432 CCACCCGTCTATCCACATATCAC No data
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282526_1054282537 6 Left 1054282526 9:63138397-63138419 CCAGACCCATTAACCACCCGTCT No data
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282521_1054282537 26 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176
1054282524_1054282537 16 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG 0: 9
1: 0
2: 1
3: 8
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282537 Original CRISPR ATATCACCCCTTGGCTGGGG TGG Intergenic
902290235 1:15430532-15430554 ATATCATCCCTTGCATGGGCTGG - Intergenic
902752632 1:18528040-18528062 ATCTCACCACTGGGCGGGGGGGG + Intergenic
903577868 1:24350336-24350358 ATATGACCTCCTGGGTGGGGTGG + Intronic
905955978 1:41996481-41996503 ATCTGACACCTGGGCTGGGGTGG + Intronic
906083476 1:43109226-43109248 ATATCACCCATTTTCTAGGGAGG - Intergenic
906175472 1:43767664-43767686 ATATCAAAACTTGGGTGGGGGGG + Intronic
906253549 1:44330278-44330300 AGATCAGCCCTTGGCTGGAATGG + Intronic
906510506 1:46407982-46408004 ATATCTCCCTCTGCCTGGGGAGG - Intronic
910680460 1:89858291-89858313 ATATCTCCTTTTGGGTGGGGTGG + Intronic
912181691 1:107226610-107226632 ATTTCACCCCTGGGCTGATGTGG - Intronic
912729638 1:112090814-112090836 AAATCAGTCCTTGGCTGGGGTGG + Intergenic
923461372 1:234212128-234212150 ATATTTCCACGTGGCTGGGGAGG - Intronic
923911721 1:238454029-238454051 ATAGCTCCACATGGCTGGGGAGG - Intergenic
1063577053 10:7271731-7271753 ATAGCTCCACATGGCTGGGGAGG + Intronic
1064418925 10:15173484-15173506 ATATAAACCCTCGGCAGGGGAGG - Intergenic
1064500219 10:15963372-15963394 ACATTTCCACTTGGCTGGGGAGG + Intergenic
1064814397 10:19242126-19242148 ATAGTTCCACTTGGCTGGGGAGG + Intronic
1064941597 10:20741513-20741535 ATAGCTCCACATGGCTGGGGAGG - Intergenic
1066633704 10:37480758-37480780 ATAACACCCCTTCCCTGGTGGGG - Intergenic
1067308823 10:45093085-45093107 ATAGCTCCACGTGGCTGGGGTGG - Intergenic
1068124914 10:52827633-52827655 AGATCACCCCTGGGCTAGAGGGG + Intergenic
1068399596 10:56510356-56510378 ATAATTCCACTTGGCTGGGGAGG - Intergenic
1071086474 10:81873816-81873838 CTTTCTTCCCTTGGCTGGGGAGG - Intergenic
1073983085 10:109177225-109177247 ATAGCTCCACATGGCTGGGGAGG + Intergenic
1074260363 10:111847581-111847603 ACAGCACCACATGGCTGGGGAGG - Intergenic
1079404632 11:20133813-20133835 TTCTCACCCCATGGTTGGGGAGG - Intergenic
1085254247 11:75163540-75163562 AGAGCCCCCCTTGGCTGGGCTGG - Intronic
1086273223 11:85093550-85093572 ATAGCTCCACATGGCTGGGGAGG + Intronic
1086816017 11:91372078-91372100 ATCTCTCCCCAGGGCTGGGGAGG - Intergenic
1091695937 12:2628063-2628085 CTTTCACTCCTTGCCTGGGGTGG - Intronic
1091762731 12:3097731-3097753 GTAACAGCCATTGGCTGGGGTGG + Intronic
1093664541 12:21795784-21795806 ATGGCTTCCCTTGGCTGGGGAGG + Intergenic
1098837592 12:75441096-75441118 ATACCTCCACATGGCTGGGGAGG - Intergenic
1098986735 12:77020351-77020373 ATAGCTCCACGTGGCTGGGGAGG + Intergenic
1104364250 12:128162700-128162722 ATAGTACCACATGGCTGGGGAGG - Intergenic
1104502135 12:129296614-129296636 ATCTCACACCTTGGATGGGAAGG - Intronic
1108827035 13:54424674-54424696 CTATCACCTCTTGGATGGGAGGG + Intergenic
1109669417 13:65585488-65585510 ATATCTGCACTTGGCTTGGGGGG + Intergenic
1109838279 13:67887480-67887502 ATAGCTCCACATGGCTGGGGAGG + Intergenic
1110337205 13:74346493-74346515 ACAGCTTCCCTTGGCTGGGGAGG - Intergenic
1110357098 13:74579014-74579036 ATAGTTCCCCATGGCTGGGGAGG - Intergenic
1110821908 13:79926329-79926351 ACCACATCCCTTGGCTGGGGTGG + Intergenic
1111186304 13:84740632-84740654 ATATCACACCTTGGCCAGGGAGG + Intergenic
1111734365 13:92119079-92119101 ATAGTTCCACTTGGCTGGGGAGG + Intronic
1111914501 13:94346754-94346776 ATGTCACCCTTTGGCGTGGGAGG + Intronic
1112536683 13:100264832-100264854 ATATCACACGTTGGCAGGGGTGG - Intronic
1113605412 13:111601078-111601100 CTATCACCCCCAGGCTGGAGTGG - Intronic
1114682884 14:24501729-24501751 ATATCACCCCTTTACTTGGTTGG - Exonic
1115112623 14:29841623-29841645 ATAGTTCCCCATGGCTGGGGAGG - Intronic
1116157841 14:41231242-41231264 ACATTTCCCCATGGCTGGGGAGG + Intergenic
1118061714 14:62145887-62145909 ATATCAGCATTTGGGTGGGGAGG + Intergenic
1122499500 14:102187394-102187416 ATGTCACACATAGGCTGGGGGGG + Intronic
1123628037 15:22241008-22241030 ATGTCACCCCTTTGCTGGCCAGG + Intergenic
1124474742 15:30023116-30023138 ACAGCTTCCCTTGGCTGGGGAGG + Intergenic
1126971040 15:54112008-54112030 ATATCACACAGTGGCTTGGGTGG - Intronic
1128742293 15:70092318-70092340 AAATCACCCTGTGGCTGTGGAGG - Intronic
1130049709 15:80473709-80473731 GTCTAAGCCCTTGGCTGGGGAGG - Intronic
1130551506 15:84892657-84892679 ACATCACCTCTTTCCTGGGGAGG + Intronic
1133410539 16:5564853-5564875 ATCTCACCTCTTGGATGAGGAGG + Intergenic
1133456898 16:5950301-5950323 ATATCAGCCCATGGCAGGGCTGG - Intergenic
1134214344 16:12305308-12305330 ATACCACTCCGTGGCCGGGGGGG - Intronic
1134294657 16:12935092-12935114 TGCTCACCCCTTGGCTGGGAAGG + Intronic
1135110977 16:19690658-19690680 ATATCATCTCTTGGCTGGGCTGG + Intronic
1137016690 16:35384185-35384207 AGACCACCCCTTGCCTGGGCAGG - Intergenic
1138543051 16:57699981-57700003 AGAGCAGCCCTTGGCTGGGAAGG - Intronic
1141708313 16:85682458-85682480 GTATCACGCCCAGGCTGGGGTGG - Intronic
1141708324 16:85682499-85682521 GTATCACGCCCAGGCTGGGGTGG - Intronic
1141889321 16:86916112-86916134 ATAGTTCCTCTTGGCTGGGGAGG - Intergenic
1141975913 16:87516326-87516348 ATGTCACCCCTTTGCTGGCCAGG - Intergenic
1145298659 17:21614078-21614100 GAATCAGCCCTTGGGTGGGGAGG + Intergenic
1147930700 17:43978799-43978821 CTCCCACCCCTTGGCTGGGTTGG + Intronic
1148792834 17:50183338-50183360 ACAACCCCCCTGGGCTGGGGTGG - Exonic
1149298519 17:55283392-55283414 ATGTCTGCCCTTGGCTTGGGTGG + Intronic
1149650893 17:58275773-58275795 ATTTCAGGCCTTGGCTGGGGAGG - Intronic
1149897882 17:60444164-60444186 ACTTCACCTCTTGGCTGTGGAGG - Exonic
1151186949 17:72371587-72371609 AAAACAGCCCTTGGCTGGTGGGG - Intergenic
1153077424 18:1180900-1180922 ATAGTTCCACTTGGCTGGGGAGG + Intergenic
1155327653 18:24681396-24681418 ATATCAGGCCTTGGCCTGGGAGG + Intergenic
1155446451 18:25917709-25917731 GGATCAGCTCTTGGCTGGGGTGG - Intergenic
1157618151 18:48999863-48999885 CTTCCACCCCTTGGCTGTGGTGG + Intergenic
1160153090 18:76410074-76410096 ATAGCTCCCCATGGCTGGGGAGG - Intronic
1165024086 19:32946812-32946834 ATAGTTCCCCGTGGCTGGGGAGG - Intronic
1167671822 19:50858020-50858042 AGATCACGCTTTTGCTGGGGAGG - Exonic
1168141825 19:54393184-54393206 ATAGTTCCACTTGGCTGGGGAGG - Intergenic
925335944 2:3099275-3099297 ATGTCTGCCCTGGGCTGGGGCGG + Intergenic
930227679 2:48811362-48811384 ACAGTACCCCATGGCTGGGGAGG + Intergenic
934086991 2:88518009-88518031 ATATCCCCACTGAGCTGGGGAGG + Intergenic
934476888 2:94599572-94599594 ATATCACCCCTTGGCTGGGGCGG + Intronic
935449015 2:103188257-103188279 ATAGCTTCCCATGGCTGGGGAGG - Intergenic
936011553 2:108928338-108928360 CTCTCACCTCATGGCTGGGGAGG - Intronic
938832672 2:135068906-135068928 ATTTTACCACTTGGCTGGGTAGG + Intronic
939109642 2:137992025-137992047 ATTGCCTCCCTTGGCTGGGGGGG - Intronic
944120283 2:196233333-196233355 ATATCATCACATGGCTGGGTTGG + Intronic
948672871 2:239579656-239579678 ACATTACCACATGGCTGGGGAGG + Intronic
949015554 2:241707836-241707858 TGGTCACCCCTTGGTTGGGGAGG - Intronic
1168772567 20:424720-424742 ATAATGCCCCTTGGCTGGGGTGG - Intronic
1169805478 20:9555034-9555056 TTATCACCCCTTGTTTGGTGGGG + Intronic
1171134787 20:22686476-22686498 ATCTCACCCCTAGGCCAGGGGGG - Intergenic
1178140257 21:29674739-29674761 ATATTTCCACATGGCTGGGGAGG - Intronic
1178366691 21:31994218-31994240 ATGTCACCCCTTTGTTAGGGAGG + Intronic
1182876217 22:33693533-33693555 ACCTCAACCCATGGCTGGGGCGG + Intronic
1184601922 22:45548886-45548908 AGGACACCCCTTGGATGGGGTGG - Intronic
949945362 3:9185457-9185479 ATGGCACCCCTTTGTTGGGGTGG + Intronic
952430378 3:33218345-33218367 AAATCACCCCTTAGCAGAGGAGG + Intronic
957232427 3:77537722-77537744 ATAGCTCCACATGGCTGGGGAGG + Intronic
959120180 3:102223307-102223329 ACAGCTTCCCTTGGCTGGGGAGG + Intronic
961038207 3:123657905-123657927 ATACCACCCCTTGGTGGGGCAGG - Intronic
963287211 3:143444846-143444868 ATATTTCCCTTTGGCTGTGGTGG + Intronic
968960490 4:3740797-3740819 CTATCATCCCTGTGCTGGGGTGG + Intergenic
971601140 4:28593576-28593598 AGAGCATCCCTTGGCTGGGTGGG - Intergenic
972095905 4:35346754-35346776 ATCTCATCCCTTGGCTCTGGTGG + Intergenic
974270900 4:59650675-59650697 ATAGTTCCACTTGGCTGGGGAGG - Intergenic
974509728 4:62823161-62823183 ATAGTTCCACTTGGCTGGGGAGG + Intergenic
976544164 4:86314519-86314541 ATAGCTCCACCTGGCTGGGGAGG - Intronic
983428816 4:167621407-167621429 ATAGTTCCACTTGGCTGGGGAGG + Intergenic
983511674 4:168615693-168615715 AGCACCCCCCTTGGCTGGGGAGG - Intronic
983526913 4:168769021-168769043 ATTTCACCATTTGGCTGGGATGG + Intronic
984095661 4:175429294-175429316 ATCTCACACCTTTCCTGGGGTGG - Intergenic
987789226 5:22542612-22542634 TTATCACCCTTTGGCTGCAGTGG + Intronic
993018746 5:82564982-82565004 AGATCACCCCTGAGCTGTGGTGG + Intergenic
993451911 5:88082024-88082046 AATTGACCCCTTGGCTGAGGAGG - Intergenic
994813607 5:104556064-104556086 ACAGTTCCCCTTGGCTGGGGTGG + Intergenic
995120432 5:108530833-108530855 ATAGTTCCCCATGGCTGGGGAGG + Intergenic
995367822 5:111383754-111383776 TTATCTCCCCTTGGCTGGGCGGG - Intronic
998228044 5:140341934-140341956 ACATCACCCCTTCCCTGGGTAGG - Intronic
999030144 5:148281516-148281538 ATGGCTTCCCTTGGCTGGGGAGG + Intronic
999364881 5:151016270-151016292 ATATAAGCCCTGGGCTGAGGAGG + Intergenic
999427074 5:151497827-151497849 AAATATCCCCTTGGCTGGAGTGG + Intergenic
1002188278 5:177466000-177466022 ACATCTGCCCTTGGATGGGGTGG - Intronic
1004022867 6:11790414-11790436 AGAACACACCTTGGCTAGGGAGG - Intronic
1005831022 6:29671189-29671211 ATGTCACATCTTGGCAGGGGTGG + Intronic
1008703551 6:54130345-54130367 ATGTCAGAACTTGGCTGGGGAGG + Intronic
1009229327 6:61043458-61043480 AGATCACCCCTGAGCTGTGGTGG - Intergenic
1011461801 6:87613159-87613181 ATAGTTCCACTTGGCTGGGGAGG + Intronic
1012240682 6:96868219-96868241 ATATCACTCCTTGGTTGGAAAGG + Intergenic
1012664600 6:101951816-101951838 ATAGTTCCACTTGGCTGGGGAGG - Intronic
1012798589 6:103795951-103795973 ATAACTCACCATGGCTGGGGAGG + Intergenic
1013935250 6:115586493-115586515 ATAGTTCCACTTGGCTGGGGAGG - Intergenic
1014129162 6:117811212-117811234 ATGGCTTCCCTTGGCTGGGGGGG + Intergenic
1016450839 6:144180616-144180638 ATAGTACCACATGGCTGGGGAGG - Intronic
1016501468 6:144725287-144725309 ATAGTTCCCCATGGCTGGGGAGG - Intronic
1018086420 6:160304851-160304873 ATATTTCCACATGGCTGGGGAGG + Intergenic
1018262443 6:161984047-161984069 TGTTCACCCCTGGGCTGGGGAGG - Intronic
1018933158 6:168255451-168255473 AAATCCCCTCTTGCCTGGGGAGG - Intergenic
1019816041 7:3201615-3201637 ATATTTCCACATGGCTGGGGAGG + Intergenic
1021036696 7:15808966-15808988 ATAGCTCCACATGGCTGGGGAGG + Intergenic
1021116413 7:16750606-16750628 ATATTTCCACATGGCTGGGGAGG - Intergenic
1021482466 7:21132817-21132839 ATAGCTCCACATGGCTGGGGAGG + Intergenic
1023139933 7:37091749-37091771 ACAGCACCACGTGGCTGGGGAGG + Intronic
1027302310 7:76852895-76852917 ACATTTCCACTTGGCTGGGGAGG + Intergenic
1031453019 7:121945527-121945549 ATATTCCCCCTTGGCTTAGGAGG + Intronic
1031526402 7:122826190-122826212 TTATCACTCCTGGGTTGGGGTGG - Intronic
1031990080 7:128191798-128191820 ATAGCTCCACATGGCTGGGGAGG - Intergenic
1032703963 7:134406109-134406131 ATAGTGCCCCATGGCTGGGGAGG - Intergenic
1032991370 7:137398244-137398266 ATATCCCCCCTTGCCTGGGGTGG - Intronic
1034531273 7:151697645-151697667 ACATAACCCCTTAGCTGTGGGGG + Intronic
1037111018 8:15164479-15164501 GTAAAACCCCTGGGCTGGGGAGG - Intronic
1039275225 8:35927542-35927564 ATATCTACCCTTTGCTGTGGAGG - Intergenic
1041727774 8:61033678-61033700 ATGTAACCACCTGGCTGGGGGGG + Intergenic
1042149727 8:65768522-65768544 ATAGCTCCACCTGGCTGGGGAGG - Intronic
1043020897 8:74998436-74998458 ATATCAGCCCTTGGTTGCTGAGG + Intronic
1043091507 8:75910401-75910423 ATATCACCACCAGTCTGGGGAGG + Intergenic
1045476337 8:102555905-102555927 CAGTCACCCCTTGGCTGTGGGGG + Intronic
1046491187 8:114954202-114954224 ACATTACCACATGGCTGGGGAGG + Intergenic
1048460591 8:134618090-134618112 ATAGTTCCACTTGGCTGGGGAGG - Intronic
1052853139 9:33390334-33390356 ATATCACCCCTTGGCTGGGGCGG - Intronic
1053681177 9:40486508-40486530 ATATCACCCCTTGGCTGGGGTGG - Intergenic
1053931166 9:43114832-43114854 ATATCACCCCTTGGCTGGGGCGG - Intergenic
1054282537 9:63138426-63138448 ATATCACCCCTTGGCTGGGGTGG + Intergenic
1054294264 9:63322023-63322045 ATATCACCCCTTGGCTGGGGTGG - Intergenic
1054392286 9:64626512-64626534 ATATCACCCCTTGGCTGGGGTGG - Intergenic
1054426934 9:65131723-65131745 ATATCACCCCTTGGCTGGGGTGG - Intergenic
1054503441 9:65889817-65889839 ATATCACCCCTTGGCTGGGGTGG + Intronic
1055200255 9:73649865-73649887 ATATAAGCCCTGAGCTGGGGAGG + Intergenic
1056190693 9:84181385-84181407 CTCTCACCCCTAGGCCGGGGGGG - Intergenic
1057863736 9:98662935-98662957 ATATCACCTCTTGGCTCCTGTGG - Intronic
1058960550 9:109989018-109989040 ATAGTTCCACTTGGCTGGGGAGG - Intronic
1059587500 9:115621706-115621728 AATTGACCACTTGGCTGGGGAGG + Intergenic
1060041817 9:120306849-120306871 ATAGAACCCTTTGGCTGGGAAGG - Intergenic
1060519634 9:124287035-124287057 ATATGCCCCCCTGGCTGCGGGGG + Intronic
1061057419 9:128231942-128231964 CTCTCAGCCCTTGGCTGAGGGGG - Intronic
1062453642 9:136625916-136625938 AGGTCACCCCGTGGCTGGGATGG - Intergenic
1185849217 X:3469699-3469721 ATAGCTCCACATGGCTGGGGAGG + Intergenic
1186049199 X:5571850-5571872 ATAGCTCCACATGGCTGGGGAGG - Intergenic
1186251203 X:7668838-7668860 ACACTTCCCCTTGGCTGGGGAGG + Intergenic
1187681184 X:21769440-21769462 CTGGCACCCCTTGGCAGGGGTGG + Intergenic
1188794332 X:34442992-34443014 ACAACACCACATGGCTGGGGAGG + Intergenic
1188830642 X:34892775-34892797 ATATCAGCACTTGCCTGGAGCGG + Intergenic
1193386119 X:80873269-80873291 ATCTCAGCCCTGGGCTGGAGTGG + Intergenic
1193888069 X:87007489-87007511 ATAGCTCCACATGGCTGGGGAGG + Intergenic
1194183042 X:90737250-90737272 ATTGCCTCCCTTGGCTGGGGTGG - Intergenic
1195178987 X:102338807-102338829 ATAGTTCCCCATGGCTGGGGAGG - Intergenic
1200529661 Y:4319205-4319227 ATTGCCTCCCTTGGCTGGGGTGG - Intergenic
1200869512 Y:8082365-8082387 CTCTCATCCCTTGGCTGGGATGG - Intergenic