ID: 1054282539

View in Genome Browser
Species Human (GRCh38)
Location 9:63138428-63138450
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282525_1054282539 11 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282524_1054282539 18 Left 1054282524 9:63138387-63138409 CCTCTTACCACCAGACCCATTAA 0: 6
1: 3
2: 0
3: 15
4: 129
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282523_1054282539 19 Left 1054282523 9:63138386-63138408 CCCTCTTACCACCAGACCCATTA 0: 6
1: 3
2: 0
3: 13
4: 142
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282526_1054282539 8 Left 1054282526 9:63138397-63138419 CCAGACCCATTAACCACCCGTCT No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282529_1054282539 -5 Left 1054282529 9:63138410-63138432 CCACCCGTCTATCCACATATCAC No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282522_1054282539 27 Left 1054282522 9:63138378-63138400 CCTCTTGTCCCTCTTACCACCAG 0: 7
1: 2
2: 0
3: 26
4: 246
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282527_1054282539 3 Left 1054282527 9:63138402-63138424 CCCATTAACCACCCGTCTATCCA No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282521_1054282539 28 Left 1054282521 9:63138377-63138399 CCCTCTTGTCCCTCTTACCACCA 0: 7
1: 2
2: 0
3: 25
4: 302
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282531_1054282539 -9 Left 1054282531 9:63138414-63138436 CCGTCTATCCACATATCACCCCT No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282530_1054282539 -8 Left 1054282530 9:63138413-63138435 CCCGTCTATCCACATATCACCCC No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data
1054282528_1054282539 2 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282539 9:63138428-63138450 ATCACCCCTTGGCTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282539 Original CRISPR ATCACCCCTTGGCTGGGGTG GGG Intergenic
No off target data available for this crispr