ID: 1054282540

View in Genome Browser
Species Human (GRCh38)
Location 9:63138432-63138454
Sequence AGGACCCCACCCCAGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 6, 1: 3, 2: 2, 3: 48, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282540_1054282544 -9 Left 1054282540 9:63138432-63138454 CCCCTTGGCTGGGGTGGGGTCCT 0: 6
1: 3
2: 2
3: 48
4: 304
Right 1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282540 Original CRISPR AGGACCCCACCCCAGCCAAG GGG (reversed) Intergenic
900136350 1:1118795-1118817 GGGACCCCACCTCTGCCAACCGG + Intergenic
900209970 1:1450603-1450625 AGGCACGCACACCAGCCAAGGGG - Exonic
900222332 1:1515934-1515956 AGGCACGCACACCAGCCAAGGGG - Intronic
900432234 1:2607806-2607828 AGGACCCTAGCCAAGCCCAGAGG - Intronic
900707238 1:4088553-4088575 ATGCCCCTACCCCAGCCCAGGGG - Intergenic
901337844 1:8466499-8466521 AAGACTCCAACCCAGCCAGGAGG + Intronic
901343563 1:8517996-8518018 AGGATCCCAGCCCAACCCAGAGG + Intronic
905696347 1:39976853-39976875 ACGACCCGATCCCAGCCAATGGG - Intergenic
906150801 1:43586392-43586414 AGGACCACCACCCAGCCCAGCGG - Intronic
906517545 1:46448474-46448496 AGGCCCCCTCCCCAGCCGGGCGG - Intergenic
906659324 1:47571392-47571414 AGGACCCCACTCCAGCATGGAGG - Intergenic
907237976 1:53064303-53064325 AACACCCTAACCCAGCCAAGGGG + Intronic
907270380 1:53287751-53287773 AGGGCCCCTGCCCAGCCCAGGGG + Intronic
912317793 1:108681981-108682003 ATGACCCGACCCCGGCCAATGGG + Intergenic
912494979 1:110085803-110085825 AGAACCCCAGCCCAGACTAGGGG + Intergenic
912943078 1:114061870-114061892 TGGATCCCACACCTGCCAAGGGG - Intergenic
912956162 1:114155171-114155193 AGGACCCTGGCCCAGCCAGGCGG + Intergenic
915459164 1:156059509-156059531 AGGAACCCATCCCAGAGAAGTGG + Intergenic
915551553 1:156638287-156638309 GGGACCCCAGCCCAGGCAGGAGG - Intergenic
918541413 1:185637296-185637318 AGGACCCCCTCTCAACCAAGGGG - Intergenic
918786938 1:188775250-188775272 AAGACACCTCCCCAGCCATGTGG + Intergenic
919459964 1:197864916-197864938 AGGAGGCCTCCCCAGCCATGTGG + Intergenic
919765337 1:201123718-201123740 ACTACCCCACCCCACCCAAGGGG + Intronic
919878006 1:201884698-201884720 AGGAGCCCAGCCCAGCCAGTGGG - Intergenic
919979276 1:202632237-202632259 AGTCCCCCACCCCAGTCAGGAGG - Intronic
920367520 1:205455845-205455867 GGGCCCCCAACCCGGCCAAGGGG + Intronic
921140988 1:212306102-212306124 ACGACCCGACCCCGGCCAATGGG - Intronic
922452285 1:225746856-225746878 AGGACCCCACCCCAGGCTACGGG + Intergenic
923488818 1:234463914-234463936 AGGTCCCCAGGCCAGCCAATAGG - Exonic
1063996528 10:11625261-11625283 ATTACCCCACCCAACCCAAGGGG - Intergenic
1064814398 10:19242132-19242154 GGGAGACCTCCCCAGCCAAGTGG - Intronic
1065056097 10:21844105-21844127 ATGAGACCTCCCCAGCCAAGTGG + Intronic
1066287658 10:33983836-33983858 AGAACCCCACCTTAGCCAACTGG - Intergenic
1066421473 10:35268408-35268430 GGGACCCAACCACAGCCATGTGG - Intronic
1067399359 10:45956765-45956787 ACGACCCAACCCCAGCCAATGGG - Intergenic
1067867677 10:49925981-49926003 ACGACCCGACCCCAGCCAATGGG - Intronic
1068399595 10:56510350-56510372 ATGAGGCCTCCCCAGCCAAGTGG + Intergenic
1069634123 10:69914945-69914967 AGGACCCCCACCAAGCAAAGAGG + Intronic
1069858897 10:71457939-71457961 AGCCCCCCACCCCTGCAAAGGGG - Intronic
1070785560 10:79160314-79160336 GTGTCCCCACCCCAGCCATGGGG - Intronic
1072141284 10:92591372-92591394 ACGACCCGACCCCAGCCAATGGG + Intergenic
1072620708 10:97077323-97077345 AGGACCGCAGCCAAGCCTAGTGG - Intronic
1072716504 10:97756026-97756048 AGCACCCCAGGGCAGCCAAGTGG - Intronic
1073105963 10:101032188-101032210 TGGCCCCCTCCCCAGCCAAAGGG - Intronic
1074432682 10:113407161-113407183 ACGATCCCACCCCAGCCAGGGGG - Intergenic
1074890683 10:117734808-117734830 GGTCCCCCACCCCAGCCAAGAGG + Intergenic
1074891833 10:117742377-117742399 ATGAGACCTCCCCAGCCAAGTGG - Intergenic
1075175909 10:120160870-120160892 TGGACCCCAGCTCAGCCCAGAGG + Intergenic
1076321900 10:129589287-129589309 TTGTCCCCACCCCAGCCAGGCGG - Intronic
1076886994 10:133267541-133267563 AGGGCCCCACCCCAGATGAGAGG + Intronic
1078269036 11:9777562-9777584 TGGACCCCCTCTCAGCCAAGGGG - Intergenic
1079304601 11:19311264-19311286 AGGACCCGCCCCCACCCAAATGG + Intergenic
1079724983 11:23869407-23869429 AGGACCCCTACTTAGCCAAGGGG - Intergenic
1080828353 11:35867156-35867178 ACCACCCCACCCCAGGCAGGAGG + Intergenic
1080840108 11:35976152-35976174 ATCACCCCACCCCATCCATGTGG - Intronic
1081651491 11:44827068-44827090 AAGACTCCAGCCCAGCCCAGAGG - Intronic
1081855390 11:46300149-46300171 AGGACACCACCCAAGGTAAGAGG + Exonic
1083316039 11:61815639-61815661 AGGACTCCAACCCAGCAGAGAGG + Intronic
1083383236 11:62285969-62285991 GTGACCCGACCCCAGCCAATGGG + Intergenic
1083737095 11:64687605-64687627 AGGACCCCAGCAGAGACAAGAGG + Intronic
1083738583 11:64695511-64695533 AGGCCGCCAGCCCAGCCACGTGG + Intronic
1084105250 11:66976510-66976532 AGGCCCCTACCCAAGCCCAGAGG - Exonic
1084599474 11:70136314-70136336 AGGAACCCGCACCAGTCAAGAGG + Intronic
1085259686 11:75197300-75197322 GGGACCCAACCCCACCCAGGTGG - Intronic
1085717670 11:78887351-78887373 AATACCCAACCCCAGCCAAGAGG - Intronic
1087210920 11:95446071-95446093 TGGACCCCATGCCTGCCAAGGGG + Intergenic
1090703942 11:129319883-129319905 AGGAGCCCACCCCACCCAACAGG + Intergenic
1091843568 12:3637718-3637740 ATGACCCGACCCCGGCCAATGGG + Intronic
1092123873 12:6062701-6062723 AAGAGCCCACCCCAGTCTAGAGG + Intronic
1097288775 12:57896904-57896926 ACCACCCCACCCCAGCTCAGGGG - Intergenic
1103703207 12:122858578-122858600 AGGAACCCACCCCTGCCCTGTGG + Intronic
1103913437 12:124364080-124364102 AGCCTCCCACCCCAGCCTAGAGG + Intronic
1104000124 12:124854964-124854986 AGGAGCCCACCCCAGGGATGAGG + Intronic
1104642471 12:130476245-130476267 GGGACCCCACCCCCAACAAGTGG - Intronic
1104673142 12:130694160-130694182 CAGGCCCCACCCCTGCCAAGAGG + Intronic
1105531535 13:21225136-21225158 ATGTCCCCTCCTCAGCCAAGTGG - Intergenic
1105967556 13:25398441-25398463 TGGATCCCCTCCCAGCCAAGGGG - Intronic
1106362686 13:29046944-29046966 ATGACCTGACCCCAGCCAATGGG + Intronic
1106883148 13:34153573-34153595 ACGACCCGACCCCGGCCAATGGG - Intergenic
1109627204 13:64991637-64991659 AGGACCCTGGCCCAGCCCAGTGG - Intergenic
1111220935 13:85205146-85205168 GGGTCCTCAGCCCAGCCAAGCGG - Intergenic
1111649679 13:91073561-91073583 AGGAGGCCTCCCCAGCCATGTGG - Intergenic
1112086252 13:96034870-96034892 TGGATCCCACACCTGCCAAGGGG - Intronic
1113697002 13:112354120-112354142 AGCCCCCCACCCCATCCAGGTGG + Intergenic
1113911490 13:113843440-113843462 GGGATCCCACCCCCGCCACGGGG - Intronic
1113967790 13:114164224-114164246 ATGCCCCCACCCCACCTAAGGGG - Intergenic
1115817527 14:37178882-37178904 ATGAGCCCTCCCCAGCCACGTGG - Intergenic
1118609310 14:67527859-67527881 AGGACCCCACCCCAGACCTCTGG + Intronic
1119650922 14:76382257-76382279 CAGACCTCAGCCCAGCCAAGGGG - Intronic
1119965164 14:78906767-78906789 AGGCCCCAGCTCCAGCCAAGTGG - Intronic
1120082836 14:80235524-80235546 ATGAGGCCTCCCCAGCCAAGTGG - Intronic
1120740658 14:88105872-88105894 AGCCCCCCACCCCACCCAGGAGG + Intergenic
1120844693 14:89115620-89115642 AGGACCCCCCCCCTCCTAAGGGG + Intergenic
1121321562 14:92994636-92994658 AGAACCCCACGCCACCCAGGTGG + Intronic
1121405742 14:93718193-93718215 AGGTCCCCAGCCCAGCCCTGGGG + Intergenic
1122431606 14:101652712-101652734 AGGATCCCACCATAACCAAGTGG + Intergenic
1122643742 14:103177679-103177701 AGGACCCCACCCACCCCAGGGGG + Intergenic
1122826582 14:104373723-104373745 AAGACCCCACCCCACCCCTGGGG - Intergenic
1123152759 14:106198845-106198867 TGGAGCCCACCCAAGCCAATCGG - Intergenic
1123696219 15:22880833-22880855 CCGCCCCCACCCCCGCCAAGTGG - Intronic
1124007584 15:25807246-25807268 AGCACCCCACCCCAGGCAGGTGG + Intronic
1124494873 15:30180193-30180215 AGTCCCCCACCCCAGTCAGGAGG - Intergenic
1124748694 15:32358452-32358474 AGTCCCCCACCCCAGTCAGGAGG + Intergenic
1125825298 15:42671471-42671493 ACGACCCAACCCCAGCCAATGGG - Intronic
1126099675 15:45111721-45111743 GGGACCGCACCCCAGCCAGGTGG - Intronic
1126103857 15:45135316-45135338 GGGACCGCACCCCAGCCAGGTGG + Intronic
1129232284 15:74203414-74203436 AGGACCCTGCCCCAGCCTGGAGG + Intronic
1129516421 15:76160341-76160363 GGGAGCCCAACCCAGCCAGGGGG + Intronic
1129674854 15:77627014-77627036 AGGCCCCCACCCCCTCCCAGAGG + Intronic
1130945114 15:88545314-88545336 TGGAGCCCACCCAAGCCAATCGG + Intronic
1131671845 15:94628076-94628098 ATGACCCCAGCCAAGCCATGTGG + Intergenic
1132169090 15:99629423-99629445 ACGACCCGACCCCAGACAATGGG - Intronic
1132640724 16:977185-977207 CAGACGCCACCCCAGCCAACAGG + Intronic
1132954193 16:2582530-2582552 AAGCCCACACCCCAGCCCAGGGG + Intronic
1132960152 16:2617633-2617655 AAGCCCACACCCCAGCCCAGGGG - Intergenic
1132986235 16:2769050-2769072 CGGAGCCAACCCCAGCCAAACGG + Exonic
1133682115 16:8129407-8129429 GCGACCCCACCCCAGCCAATGGG - Intergenic
1135850482 16:25958790-25958812 AGGAGCCAACACCAGCCATGAGG - Intronic
1136707782 16:32202930-32202952 GGGACCCCGCCCCAACCCAGGGG + Intergenic
1136760127 16:32726481-32726503 GGGACCCCGCCCCAACCCAGGGG - Intergenic
1136807977 16:33143905-33143927 GGGACCCCGCCCCAACCCAGGGG + Intergenic
1138269522 16:55685132-55685154 AGGACACCACGCCTGCCCAGAGG - Exonic
1139609931 16:68048685-68048707 AAGTCACAACCCCAGCCAAGTGG - Intronic
1141143517 16:81513444-81513466 AGGAGCCCACTCCAGCCAGGTGG - Intronic
1142224548 16:88871198-88871220 GGCTCCCCACCCCAGCCAGGTGG + Intergenic
1142286573 16:89173863-89173885 GGGACCCCACCCCAGCTGGGAGG + Intronic
1203062283 16_KI270728v1_random:986803-986825 GGGACCCCGCCCCAACCCAGGGG - Intergenic
1143056290 17:4164458-4164480 AGCTCCCCACCCCAGCCTGGTGG - Intronic
1143715895 17:8768778-8768800 ACAACCCGACCCCAGCCAATGGG + Intergenic
1144093965 17:11883077-11883099 AGCACCCCACTCCAGCCTCGAGG + Intronic
1144439851 17:15271811-15271833 AGGACTCCAGGCCAGCGAAGAGG + Intergenic
1144540417 17:16135871-16135893 AAGACCCCACCCCAACAAAAGGG + Intronic
1144858627 17:18285444-18285466 TGGGCCTCACCCCAGACAAGCGG - Exonic
1144881033 17:18430814-18430836 AGAGCCCCACCCCTGCCAAGAGG - Intergenic
1144886485 17:18466665-18466687 TGGAGCCCACCTCAGCCAGGTGG + Intergenic
1145145722 17:20477643-20477665 TGGAGCCCACCTCAGCCAGGTGG - Intergenic
1145151199 17:20513573-20513595 AGAGCCCCAACCCTGCCAAGAGG + Intergenic
1145763635 17:27443118-27443140 TGGAGCCCACCTCAGCCAGGTGG + Intergenic
1146162556 17:30567830-30567852 AGAGCCCCACCCCTGCCAAGAGG + Intergenic
1146472360 17:33134735-33134757 GGGAGCCCTCCCCAGCCAAGTGG - Intronic
1147851153 17:43443987-43444009 AGGGCCCCACCCCAGTCAATGGG - Intergenic
1147930705 17:43978805-43978827 GGGGCCCCAACCCAGCCAAGGGG - Intronic
1148156948 17:45430021-45430043 AGGTCCCCACCCGAGCCCCGCGG - Intronic
1148465292 17:47861262-47861284 AGGCCCCCACCCCGGCCAGAGGG - Intergenic
1148778685 17:50109875-50109897 ACCACCCCACCCCAGCTCAGCGG - Intronic
1150611687 17:66738714-66738736 AGGGCTCCTCCCCAGCCAAGTGG - Intronic
1151454142 17:74215975-74215997 GGGAATCCACCCCAGCCAACTGG - Intronic
1151868324 17:76819772-76819794 AGCAGCCCACCCCAGTGAAGTGG - Intergenic
1152426969 17:80223236-80223258 AGGAACCCTGGCCAGCCAAGAGG - Exonic
1154128733 18:11717072-11717094 AGGTCCCCAGCCCTGCCACGCGG + Intronic
1154355244 18:13619677-13619699 CCGGCCCCGCCCCAGCCAAGGGG - Intronic
1155170738 18:23265268-23265290 CAGCCTCCACCCCAGCCAAGGGG + Intronic
1157078370 18:44493580-44493602 GGGACACCTCCCCAGCCATGTGG + Intergenic
1157323103 18:46649124-46649146 AGGATCCCACCAAGGCCAAGTGG + Intronic
1157333600 18:46721148-46721170 AGGACCCAACCACAACCAAGCGG - Intronic
1157517927 18:48324210-48324232 AGGGGCCCAACCCAGCCCAGAGG + Intronic
1159496417 18:69213281-69213303 CTGAGCCCACCCCAGCCATGTGG - Intergenic
1160764183 19:799828-799850 AGGTCCCCTCCACAGCCAGGTGG - Intronic
1160867568 19:1262562-1262584 AGCAGCCCAGCCCAGCCCAGCGG + Intronic
1160999097 19:1900314-1900336 GTGACCCGACCCCAGCCAATAGG - Intergenic
1162069944 19:8147530-8147552 AGCCCCCCACCCTAGCCATGGGG + Intronic
1162104820 19:8364040-8364062 AGGACCCCACCCCCGGCCACAGG + Intronic
1162374972 19:10299616-10299638 AGGCCCCCACCCCTGCCCAAGGG - Intergenic
1162450594 19:10751993-10752015 ATGACCCGACCCCGGCCAATGGG - Intronic
1163886260 19:19967258-19967280 AGCCCCCAGCCCCAGCCAAGGGG - Intergenic
1164671884 19:30076956-30076978 AGGAGCCCTCCCCAACAAAGAGG - Intergenic
1165099835 19:33432439-33432461 AGGAGCCCACCCCACCCCAGGGG + Intronic
1165178747 19:33949329-33949351 AGAACACCACCCCAGCCTGGAGG - Intergenic
1165658666 19:37555692-37555714 TGGAGCCCACCCAAGCCAATCGG - Intronic
1166359587 19:42247666-42247688 AGCCCCCCACCCCACCCCAGAGG + Exonic
1166655419 19:44607721-44607743 ACGACCCAACCCCAGCCAATGGG + Intergenic
1167414197 19:49361800-49361822 AAGACCCCAGCCAAGCCCAGTGG + Intronic
1167563681 19:50242366-50242388 TGGAGGCCACCCCAGCCACGTGG - Intronic
1168315927 19:55484796-55484818 GGGACCCCACTCCACCCACGGGG - Intergenic
925385297 2:3457992-3458014 AGGAGCCCAGCCCAGCCGAAGGG + Intronic
925825638 2:7846135-7846157 AGGCCCCCACCCCTGCTTAGTGG - Intergenic
926088194 2:10033197-10033219 AGGACTCCTCCTGAGCCAAGAGG + Intergenic
926335570 2:11860103-11860125 CTGAAGCCACCCCAGCCAAGTGG - Intergenic
927872079 2:26630117-26630139 AGGATCCCATCCCAGTCAAGAGG + Intronic
929763759 2:44827449-44827471 AGGCCCCCACCCCCACCCAGGGG + Intergenic
930544020 2:52744715-52744737 AGGAGGCCTCCCCAGCCATGTGG + Intergenic
931445928 2:62327259-62327281 GTGACCCCTCCCCAGCCAAGTGG - Intergenic
932916792 2:75868212-75868234 TGGGCCCCAACCAAGCCAAGAGG - Intergenic
934476891 2:94599578-94599600 AGGACCCCGCCCCAGCCAAGGGG - Intronic
935281957 2:101526037-101526059 ACAACCCGACCCCAGCCAATGGG - Intergenic
935379440 2:102436194-102436216 AAGACCTCACCTAAGCCAAGGGG - Intronic
936053357 2:109242159-109242181 AGGACACCAACACAGACAAGAGG - Intronic
937154659 2:119710503-119710525 AGGAGCCCACCCCAGACAGAGGG + Intergenic
938628447 2:133137935-133137957 ACGACCCCACCTCAGCCAATGGG - Intronic
943152676 2:184133914-184133936 AGGAGGCCTCCCCAGCCATGTGG + Intergenic
946923540 2:224603828-224603850 AGGACCCGAGCCCTGCCACGCGG + Intergenic
947195097 2:227556019-227556041 AGGACCGCTACCCAGCCTAGAGG + Intronic
947605068 2:231480921-231480943 GGGATCCCACCCCAGCCCTGGGG - Intronic
948462279 2:238135812-238135834 AGGCCCCCAGCCCAGCAGAGGGG - Intergenic
1168772566 20:424714-424736 TGGAGTCCACCCCAGCCAAGGGG + Intronic
1168808636 20:688531-688553 AGGCCCCCAACCCAGCCCAGAGG + Intergenic
1169042591 20:2508464-2508486 ACGTCCCCACCCCAGCCGCGGGG + Intronic
1169563711 20:6829576-6829598 AGGACTCCTCCCCAACCAGGTGG - Intergenic
1170091449 20:12593455-12593477 AGGTCCCTACCCCAGCAAAGAGG - Intergenic
1171435146 20:25116444-25116466 AGGAGACCACCTAAGCCAAGTGG + Intergenic
1172109267 20:32536008-32536030 CAGCCCCCACCCCAGGCAAGGGG + Intronic
1173003783 20:39124302-39124324 ATGACCCCCACCCAGCCAGGGGG + Intergenic
1174138350 20:48395929-48395951 ACAACCCGACCCCAGCCAATGGG + Intergenic
1174992095 20:55522551-55522573 AGTACATCTCCCCAGCCAAGGGG - Intergenic
1175075056 20:56365085-56365107 AGGACCCCAGCCAGGCCACGGGG + Exonic
1175316950 20:58055152-58055174 TGGGCCCCAACCCAGCCAGGAGG - Intergenic
1175770148 20:61618353-61618375 CGGACCCCATCTCAGCCAAGGGG - Intronic
1175787526 20:61721368-61721390 AGGAGCCCACCCCGGCCTGGAGG + Intronic
1175809913 20:61852384-61852406 TGGACATCACCCCATCCAAGGGG + Intronic
1176596679 21:8704300-8704322 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1176745540 21:10649064-10649086 ATGAGACCACCCCAGCCATGTGG + Intergenic
1176983224 21:15406945-15406967 AGCACCACAGTCCAGCCAAGCGG + Intergenic
1177267579 21:18804465-18804487 ATGACCTGACCCCAGCCAATGGG + Intergenic
1178603321 21:34013766-34013788 ATGAGGCCTCCCCAGCCAAGTGG - Intergenic
1179649177 21:42795654-42795676 AGGACCTGACCCCAGCCAATGGG + Intergenic
1179804951 21:43831471-43831493 AGGTCACCACCCCCACCAAGCGG - Intergenic
1180149332 21:45939746-45939768 AGGAGGCCCACCCAGCCAAGAGG - Intronic
1180198904 21:46213259-46213281 AGGGCCACACCCAAGGCAAGGGG + Intronic
1181064399 22:20298883-20298905 AGGTCCCCAGGCCAGCCAGGTGG - Intergenic
1181901124 22:26156581-26156603 AGCACCCCAAACCAGCCAAATGG + Intergenic
1182457366 22:30460471-30460493 AGAACCCCACTTCATCCAAGGGG - Intronic
1183050041 22:35253557-35253579 ATGACCCCATCCCAGCCAATTGG + Intergenic
1183201134 22:36386842-36386864 AGGACCCCAGCACAGGGAAGCGG + Intronic
1183633268 22:39046097-39046119 GGGACCCCCTGCCAGCCAAGAGG - Intronic
1183741510 22:39671011-39671033 AGGACCCCACCCCAGGGATAGGG + Intronic
1184840868 22:47051684-47051706 CTGCCCCCACCCCAGGCAAGCGG - Intronic
1185132734 22:49048918-49048940 AAGACACCATCCCAGTCAAGTGG - Intergenic
949128025 3:469950-469972 AGGACCCAACCCCAGCATTGGGG - Intergenic
949933956 3:9102124-9102146 AGGACCCCAGCTCAGACATGGGG + Intronic
950552804 3:13676937-13676959 TGGAGCCCACTCCACCCAAGTGG + Intergenic
952028993 3:29118983-29119005 AGGACTCCTCCCCAGCCATGTGG + Intergenic
953232008 3:41073863-41073885 AGGACCCCTCCCCACCAAACAGG + Intergenic
953903900 3:46858678-46858700 GGGACCCCCTCCCAGCCTAGTGG - Intronic
954760364 3:52869422-52869444 AGGGCCCCTCCCACGCCAAGGGG - Intronic
954813093 3:53259998-53260020 AGGGCTGCACCCAAGCCAAGAGG + Intergenic
956847406 3:73196088-73196110 AGGACGCCATCACAGCCTAGAGG - Intergenic
959264246 3:104117732-104117754 AGGCCCCCACCCCAGCCACGTGG + Intergenic
962777080 3:138671832-138671854 ACAACCCAACCCCAGCCAATGGG - Intronic
962893473 3:139693166-139693188 AGGCCCTCACCTCAGCCATGAGG + Intergenic
963328807 3:143891779-143891801 AAAACCCAACCCCATCCAAGGGG - Intergenic
965039006 3:163482037-163482059 ATGAGCCCTCCCCAGCCATGTGG + Intergenic
965757329 3:172039995-172040017 GGGACCCCAGCCCAGCAAGGCGG - Intronic
965969238 3:174533150-174533172 ATGACCCAACCCCAGCCAATGGG + Intronic
966918611 3:184598138-184598160 AGACCCCGACCCCAGCCCAGAGG - Intronic
967494623 3:190128944-190128966 AGCAGCCCACCCCAGCCAGATGG + Intergenic
968299736 3:197603471-197603493 AGGATCTCAGCCCAGCCACGTGG + Intergenic
968492148 4:895763-895785 AGGAGACCACCCCAGCCATCAGG + Intronic
969916788 4:10499212-10499234 AAGACCTGACCCCAGCCAATGGG + Intronic
970741933 4:19249750-19249772 CTGAGGCCACCCCAGCCAAGTGG + Intergenic
971653669 4:29312470-29312492 AGGACCCCACCAAAGGGAAGAGG - Intergenic
976453390 4:85218229-85218251 AGGATAACACCCCAGCCATGAGG - Intergenic
980106602 4:128594314-128594336 ATGACCCAACCCTAGCCAACAGG - Intergenic
980755169 4:137149073-137149095 GTGAGGCCACCCCAGCCAAGTGG - Intergenic
982692793 4:158567132-158567154 AGGTCCCGAGCCCTGCCAAGCGG - Intronic
983864826 4:172753267-172753289 AAGCCCCCACCTCAGCCATGTGG + Intronic
985487092 5:158054-158076 GGAACCCCACACCAGGCAAGTGG + Intronic
987105000 5:14629954-14629976 TGAGGCCCACCCCAGCCAAGTGG - Intergenic
989296854 5:39838623-39838645 CTGAGCCCACCCCAGCCATGTGG + Intergenic
991195727 5:63930001-63930023 ACGACCCGACCCCAGCCAATGGG - Intergenic
991532116 5:67627109-67627131 AGTACCCCACCCCCACCAACAGG + Intergenic
994561740 5:101382533-101382555 ATGAGGCCTCCCCAGCCAAGTGG - Intergenic
994813611 5:104556070-104556092 TAGCCCCCACCCCAGCCAAGGGG - Intergenic
994921709 5:106053657-106053679 AGAACCCCAACCCAGTCAATAGG + Intergenic
997824685 5:137096009-137096031 ATGACCCCACCCCATCAATGAGG - Intronic
998261908 5:140638202-140638224 ATGACCCGACCCCGGCCAATGGG - Intergenic
998397965 5:141831601-141831623 TGGAGCCCAGCCCAGCCAGGGGG - Intergenic
999366815 5:151028770-151028792 AAGACGCCACCCCTGCCATGGGG - Exonic
1001424473 5:171614479-171614501 AGGGCCCCAGCCCAGACAAATGG - Intergenic
1003391115 6:5713813-5713835 ACGGCCCCTCCCCAGCCAAGTGG + Intronic
1003927990 6:10895387-10895409 ACGACCCGACCCCGGCCAATGGG - Intronic
1004129956 6:12910133-12910155 GGGGCCCCAGACCAGCCAAGAGG + Intronic
1004293233 6:14387329-14387351 ATGACCCGACCCCGGCCAATGGG - Intergenic
1004413647 6:15404463-15404485 AGGGCCCTACCTCAGCCATGGGG + Intronic
1005029940 6:21499395-21499417 AGGACCCCACCCCAGACCTTCGG + Intergenic
1005968628 6:30744152-30744174 AGGAACCGAACCCAGCCAAAAGG - Exonic
1005989303 6:30893218-30893240 AGGGTCCCACCCTAGCCGAGGGG - Intronic
1006084513 6:31586733-31586755 AGCTCTCCACACCAGCCAAGGGG + Intronic
1006171946 6:32098065-32098087 CGGCCCCCTCCCCAGCCAGGGGG - Intronic
1006920671 6:37625233-37625255 CGGGCCCCACCCCAGCCAAGAGG - Intergenic
1007956631 6:45923848-45923870 AGGACCCCAGCCCAGGCAGCTGG - Intronic
1008092601 6:47308802-47308824 GAGACCCCACCCGAGCCAAGAGG + Intronic
1011347580 6:86388941-86388963 ATGAGGCCACCCCAGCCATGGGG + Intergenic
1017433951 6:154398145-154398167 ACAACCCCACCCCAGTCCAGTGG + Exonic
1017907873 6:158769256-158769278 AGGGCCCCACCGCAGGCAATTGG + Intronic
1018859361 6:167699455-167699477 AGGACTCAGCCCCAGCCACGGGG - Intergenic
1019292520 7:257673-257695 AGGACCCTTCCCCAGGCCAGAGG + Intronic
1019322545 7:422236-422258 AGGACCCCACCGCGGCCAAAGGG + Intergenic
1019706368 7:2499005-2499027 AGGCCCAGACTCCAGCCAAGTGG - Intergenic
1019899445 7:4008486-4008508 ATGACCCGACCCCGGCCAATGGG - Intronic
1020077282 7:5266758-5266780 CCTCCCCCACCCCAGCCAAGTGG + Intergenic
1023241991 7:38158455-38158477 TGGACTCCCTCCCAGCCAAGGGG - Intergenic
1023276174 7:38521183-38521205 AGGAAACTACCCCAGACAAGAGG + Intronic
1023809506 7:43901255-43901277 AAGAGCCCACCCCAGCTCAGGGG - Intronic
1023822091 7:43986140-43986162 AGGGCCCCGCCCCTCCCAAGAGG + Intergenic
1023969354 7:44979633-44979655 AATTCCCCACCCCAGCCACGGGG + Intergenic
1024117112 7:46205009-46205031 AGGAACCCACCTCAGCCTAATGG - Intergenic
1027793925 7:82668393-82668415 AGGAGGCCTCCCCAGCCATGAGG - Intergenic
1029538625 7:101170298-101170320 CCTACCCCACCCCTGCCAAGCGG - Intergenic
1029750355 7:102539554-102539576 AGGGCCCCGCCCCTCCCAAGAGG + Intronic
1029768307 7:102638662-102638684 AGGGCCCCGCCCCTCCCAAGAGG + Intronic
1029962198 7:104699941-104699963 AGGCCCCCACCTCAGCCATCAGG + Intronic
1031479081 7:122256734-122256756 AGGATCCCACCTCAGGCAAAGGG + Intergenic
1033363791 7:140656274-140656296 AGGACCTCTCCAAAGCCAAGTGG + Intronic
1034493048 7:151404557-151404579 AGGCCCCCACCCCAACCCCGAGG + Intronic
1035686630 8:1528259-1528281 AGGAGCCCACCCCAGGCAGGAGG + Intronic
1035758969 8:2055420-2055442 AGGAATCTACCCCAGGCAAGAGG + Intronic
1036066653 8:5388274-5388296 AGCAGCCCAAACCAGCCAAGTGG + Intergenic
1037003211 8:13746736-13746758 AGGAGGCCTCCCCAGCCATGTGG - Intergenic
1037111016 8:15164473-15164495 TGGAGCCCTCCCCAGCCCAGGGG + Intronic
1037884898 8:22590731-22590753 AGGAGCCCACACCAGCCACTGGG - Intronic
1039441276 8:37596997-37597019 AGGCCCACATCCCATCCAAGAGG + Intergenic
1040501181 8:48006914-48006936 TGCACTCCACCCCAGCCTAGGGG - Intergenic
1046525248 8:115374879-115374901 ATGACACCTCCCCAGCCACGTGG + Intergenic
1046867396 8:119165540-119165562 TGGACCCCCTCTCAGCCAAGAGG - Intronic
1047630449 8:126700553-126700575 ATGAGCCCTCCCCAGCCATGTGG + Intergenic
1048439352 8:134448530-134448552 GGAACCCAACCCGAGCCAAGGGG + Intergenic
1049422980 8:142525062-142525084 AGGGCCACACCCCATCCTAGTGG + Intronic
1049551286 8:143261140-143261162 TGGACCCCACCACAGCCAACAGG - Intronic
1050479921 9:6079011-6079033 AGGGCCCGACCCCGGCCAATGGG + Intergenic
1050525568 9:6543515-6543537 AGGTCCCCACCATAGCCAAGAGG + Intronic
1050848033 9:10248090-10248112 AGGAGACCTCCCCAGCCATGTGG + Intronic
1052853136 9:33390328-33390350 AGGACCCCGCCCCAGCCAAGGGG + Intronic
1053477714 9:38394049-38394071 ACGACCTGACCCCAGCCAATGGG + Intronic
1053681174 9:40486502-40486524 AGGACCCCACCCCAGCCAAGGGG + Intergenic
1053695736 9:40637873-40637895 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1053931163 9:43114826-43114848 AGGACCCCGCCCCAGCCAAGGGG + Intergenic
1054282540 9:63138432-63138454 AGGACCCCACCCCAGCCAAGGGG - Intergenic
1054294261 9:63322017-63322039 AGGACCCCACCCCAGCCAAGGGG + Intergenic
1054306983 9:63437091-63437113 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1054392283 9:64626506-64626528 AGGACCCCACCCCAGCCAAGGGG + Intergenic
1054405714 9:64761079-64761101 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1054426931 9:65131717-65131739 AGGACCCCACCCCAGCCAAGGGG + Intergenic
1054439341 9:65246566-65246588 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1054491066 9:65775373-65775395 AGGACCCCAAAGCATCCAAGTGG - Intergenic
1054503444 9:65889823-65889845 AGGACCCCACCCCAGCCAAGGGG - Intronic
1055007108 9:71520609-71520631 AGGACCCAATCCAGGCCAAGCGG + Intergenic
1055330513 9:75178325-75178347 ACGACCCAACCCCAGCCAATGGG - Intergenic
1056430906 9:86526853-86526875 TGGAGGCCACCCCAGCCAAGGGG + Intergenic
1057131364 9:92656634-92656656 CGGACCCCACCACAAGCAAGGGG + Intronic
1058699169 9:107586827-107586849 AGGAACCCATCACAGCCAGGTGG - Intergenic
1059357008 9:113707679-113707701 GGGAGGCCTCCCCAGCCAAGTGG + Intergenic
1061360160 9:130136472-130136494 TGGAGCCCACCCCTGCCTAGGGG + Exonic
1061369204 9:130188371-130188393 AGGAACCCAACCTAGCCTAGGGG - Intronic
1062344273 9:136107646-136107668 AGGCACGCACCCCAGCCAGGTGG + Intergenic
1062393271 9:136342490-136342512 AGGACCCTTCCCCAGCCCTGGGG - Intronic
1202778181 9_KI270717v1_random:11485-11507 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1185461299 X:333786-333808 GGGGCCCCTCCCCAGCCAGGGGG - Intergenic
1185625438 X:1478077-1478099 CTGACCCCACCCCAGCTCAGGGG - Intronic
1185969207 X:4643034-4643056 AGGCCTCCTCCCCAGCCATGAGG + Intergenic
1186251204 X:7668844-7668866 GTGACGCCTCCCCAGCCAAGGGG - Intergenic
1186340781 X:8644251-8644273 TGGACCCCATCTTAGCCAAGGGG + Intronic
1188590082 X:31823057-31823079 ACGACCCAACCCCAGCCAATGGG + Intronic
1189372363 X:40438937-40438959 ACGACCCGACCCAAGCCAATGGG - Intergenic
1190660462 X:52649581-52649603 AAGCCCCCATCCCAGCCCAGGGG - Intronic
1192497243 X:71623969-71623991 ATGGCTCCAGCCCAGCCAAGTGG - Intergenic
1194302466 X:92204813-92204835 AGGCCCCCTTCCCAGCCATGGGG - Intronic
1198626281 X:138579195-138579217 GTGAGACCACCCCAGCCAAGTGG + Intergenic
1198864317 X:141105280-141105302 ATGACCCGACCCCAGCCAATGGG + Intergenic
1198898372 X:141482136-141482158 ATGACCCGACCCCAGCCAATGGG - Intergenic
1199150959 X:144486209-144486231 ACCACCCGACCCCAGCCAATAGG - Intergenic
1199308183 X:146292401-146292423 AGCACACCACCTCAACCAAGGGG - Intergenic
1199355294 X:146855437-146855459 ATGAGCCCTCCCCAGCCATGTGG + Intergenic
1201152778 Y:11102859-11102881 AGGACCGCACCTCAGAGAAGTGG - Intergenic