ID: 1054282541

View in Genome Browser
Species Human (GRCh38)
Location 9:63138433-63138455
Sequence GAGGACCCCACCCCAGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 6, 1: 3, 2: 4, 3: 48, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282541_1054282544 -10 Left 1054282541 9:63138433-63138455 CCCTTGGCTGGGGTGGGGTCCTC 0: 6
1: 3
2: 4
3: 48
4: 418
Right 1054282544 9:63138446-63138468 TGGGGTCCTCTCTTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282541 Original CRISPR GAGGACCCCACCCCAGCCAA GGG (reversed) Intergenic
900177805 1:1298494-1298516 GAGGACCCCACCCCCGCCTGAGG + Intronic
900177814 1:1298513-1298535 GAGGACCCCACCCCCGCCTAAGG + Intronic
900189433 1:1347090-1347112 AAGGCCCCCATCCCAGCCAGAGG + Intronic
900482219 1:2904882-2904904 GAGGACCCCATGACAGGCAAGGG + Intergenic
900532234 1:3160275-3160297 AATGATCCCACACCAGCCAACGG - Intronic
900566472 1:3334624-3334646 GAGGAGACCAGCCCAGCCCAGGG + Intronic
900586127 1:3433158-3433180 GAGCACCCCAAAGCAGCCAAGGG + Intronic
900707239 1:4088554-4088576 GATGCCCCTACCCCAGCCCAGGG - Intergenic
902393352 1:16118981-16119003 GGGGCCCCCACCCCAGGCAGGGG + Intergenic
902822155 1:18950013-18950035 GAGAATGCCAACCCAGCCAAGGG + Intronic
903258395 1:22117848-22117870 GAGGACCCCTCCCCTCCCAGAGG - Exonic
905442924 1:38005995-38006017 GAGGACCCCTCCCCACCATAGGG + Intergenic
905463090 1:38134046-38134068 GAGGCCCCCACCCCGGCCCTGGG - Intergenic
905696348 1:39976854-39976876 TACGACCCGATCCCAGCCAATGG - Intergenic
905952542 1:41964319-41964341 GAGCTCCCAGCCCCAGCCAAGGG + Intronic
906138968 1:43521988-43522010 GTTGTCCCCACCCCTGCCAAGGG - Intergenic
906210871 1:44011528-44011550 CAGGGCCCCTCCCCAGCCATGGG - Intronic
907270379 1:53287750-53287772 GAGGGCCCCTGCCCAGCCCAGGG + Intronic
909677748 1:78257132-78257154 GAGCTCCCATCCCCAGCCAAGGG + Intergenic
910619441 1:89236526-89236548 GAGCTCCCGCCCCCAGCCAAAGG - Intergenic
912024990 1:105159024-105159046 GAGGAACCCACATCAGGCAAGGG + Intergenic
912317792 1:108681980-108682002 CATGACCCGACCCCGGCCAATGG + Intergenic
915051824 1:153083700-153083722 GAGGAACCCACTCCCGCCATGGG + Intergenic
915088867 1:153407483-153407505 GTGGAGCCCACCACAGCTAAAGG + Intergenic
916343145 1:163758769-163758791 GAGCCCCCACCCCCAGCCAAGGG + Intergenic
917059058 1:171017351-171017373 GAGCCCCCACCCCCAGCCAAGGG + Intronic
917682825 1:177385035-177385057 GAGTGCCCATCCCCAGCCAAGGG - Intergenic
918554619 1:185783971-185783993 GTGGAGCCCACCGCAGCTAAAGG - Intronic
919765336 1:201123717-201123739 TACTACCCCACCCCACCCAAGGG + Intronic
919878007 1:201884699-201884721 CAGGAGCCCAGCCCAGCCAGTGG - Intergenic
919900754 1:202042690-202042712 CAGGCCCCCACCCCAGCCAAGGG + Intergenic
919926912 1:202196210-202196232 TGGGACCCCTCCCCAGCCCAGGG - Intronic
920967639 1:210714406-210714428 GAGGCCCCAACCCCAGGTAAAGG - Intronic
921140989 1:212306103-212306125 TACGACCCGACCCCGGCCAATGG - Intronic
922452284 1:225746855-225746877 CAGGACCCCACCCCAGGCTACGG + Intergenic
923225479 1:231935229-231935251 GGGGGACCCACCCCACCCAATGG - Intronic
923917829 1:238529390-238529412 CTGGATCCCACACCAGCCAAGGG + Intergenic
1063996529 10:11625262-11625284 GATTACCCCACCCAACCCAAGGG - Intergenic
1065060804 10:21899047-21899069 GAACCCCCAACCCCAGCCAAGGG + Intronic
1065267465 10:23992649-23992671 AAGGAACGCATCCCAGCCAAAGG + Intronic
1067399360 10:45956766-45956788 TACGACCCAACCCCAGCCAATGG - Intergenic
1067867678 10:49925982-49926004 TACGACCCGACCCCAGCCAATGG - Intronic
1068477947 10:57551905-57551927 GTGGAGCCCACCACAGCCCAAGG - Intergenic
1069891904 10:71657191-71657213 CAGGACCCCAACCCCGCCTAGGG - Intronic
1069904435 10:71724119-71724141 GAGGACCGCCCCCCATCCTAGGG - Intronic
1070560336 10:77561690-77561712 GAGGTCTCCAGCCTAGCCAATGG - Intronic
1070655386 10:78267628-78267650 GAGGGCACCACCCCAGCCCAGGG - Intergenic
1071253274 10:83842400-83842422 CAGGACCCCACCCCAGGCTATGG + Intergenic
1071515230 10:86292566-86292588 GGGGACCCCTCCCCAGCCTCAGG - Intronic
1072141283 10:92591371-92591393 TACGACCCGACCCCAGCCAATGG + Intergenic
1072869229 10:99099508-99099530 GTGGAACCCACCACAGCTAAAGG + Intronic
1073016857 10:100406832-100406854 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1073105964 10:101032189-101032211 CTGGCCCCCTCCCCAGCCAAAGG - Intronic
1073179627 10:101575742-101575764 GAGGTCCCCACCCCAGGCCCTGG + Intronic
1074432683 10:113407162-113407184 AACGATCCCACCCCAGCCAGGGG - Intergenic
1075195841 10:120358412-120358434 GAGGACCCCTCCCCATCCTCTGG - Intergenic
1076657956 10:132036885-132036907 GAGGACCCCGCCCCAGACAGGGG - Intergenic
1076675845 10:132147373-132147395 GAGTCCCCCACCCCTTCCAAAGG - Intronic
1077417920 11:2433450-2433472 GAGCCCCCTACCCCAGCCACTGG - Intergenic
1077450362 11:2639268-2639290 GAGCACCTCTCCCCATCCAAAGG - Intronic
1077784971 11:5373840-5373862 GTGGACCCCACCACAGCTCAAGG + Intronic
1078491722 11:11775598-11775620 GAGGACCCCATCTCAGCCAATGG - Intergenic
1082193369 11:49273475-49273497 GAGGTCCCTCCCCCAGCCAGTGG - Intergenic
1082810683 11:57477169-57477191 GGGGGCCCCACCCCAGCCTTGGG - Exonic
1082835000 11:57645312-57645334 GCTGTCCCCACCCCACCCAATGG + Exonic
1082877080 11:57999665-57999687 GTGGACCCCACCACAGCTGAAGG - Intergenic
1083383235 11:62285968-62285990 TGTGACCCGACCCCAGCCAATGG + Intergenic
1084301314 11:68254415-68254437 GAAGACTCCACCCCAGCCTCTGG - Intergenic
1085298491 11:75444538-75444560 GATGTACCCTCCCCAGCCAATGG + Intronic
1085462505 11:76702526-76702548 GAGGGCCCCAACCCAGCTAGGGG - Intergenic
1085637347 11:78168942-78168964 CAGGACCCCACCCGACACAAGGG - Intergenic
1086301474 11:85431320-85431342 GAGCCCCCACCCCCAGCCAAGGG + Intronic
1086439290 11:86812363-86812385 GATGACCCCACCCCATCAAAAGG - Intronic
1087328756 11:96753883-96753905 GGAGCCCCCGCCCCAGCCAAGGG - Intergenic
1087542444 11:99537472-99537494 TAAGACCCCTCCCCACCCAATGG + Intronic
1088004757 11:104926984-104927006 GAGCCCCACATCCCAGCCAAGGG + Intergenic
1091424511 12:375629-375651 GAGCACCTCTCCCCCGCCAAAGG - Intronic
1091843567 12:3637717-3637739 TATGACCCGACCCCGGCCAATGG + Intronic
1094792329 12:33929333-33929355 GAGCACCTCTCCCCATCCAAAGG + Intergenic
1095718189 12:45371347-45371369 GTGGACCCCACCACAGCTCAAGG + Intronic
1096475404 12:51906602-51906624 AGGGCCCCCACCCCAGCAAATGG - Intergenic
1097038542 12:56140150-56140172 GAGAACCGCGCCCCAGCCTAAGG + Intronic
1097455421 12:59793205-59793227 GGAATCCCCACCCCAGCCAAGGG - Intergenic
1098694609 12:73537398-73537420 GAGCCCCCACCCCCAGCCAAGGG + Intergenic
1101187294 12:102292486-102292508 GAGCTCCCACCCCCAGCCAAGGG - Intergenic
1102236771 12:111298630-111298652 GAGACCCCCACCCCAGGCAGAGG - Intronic
1102944820 12:116977008-116977030 GAGAGCCCCACCCCAGACATCGG + Intronic
1104903801 12:132203112-132203134 GCGGACCCCTCCCCAGCCCCGGG - Intronic
1104935965 12:132364664-132364686 GAGGGCCTCACCCCTGCCAACGG - Intergenic
1106362685 13:29046943-29046965 TATGACCTGACCCCAGCCAATGG + Intronic
1106386593 13:29291489-29291511 GAGAACCCCATGCCAGCCACTGG + Intronic
1106425434 13:29624765-29624787 GAGACCCCACCCCCAGCCAAGGG + Intergenic
1106544014 13:30714951-30714973 GATGACCCCTTCCAAGCCAAGGG - Intronic
1106737970 13:32607681-32607703 GCCCACCCCACCCCAGCTAAAGG - Intronic
1106883149 13:34153574-34153596 TACGACCCGACCCCGGCCAATGG - Intergenic
1108336224 13:49444427-49444449 GAGGAACCCAGCCTTGCCAACGG + Exonic
1108496112 13:51026868-51026890 GTGGACCCCATCACAGCAAATGG - Intergenic
1110836974 13:80094082-80094104 GAGCCCCCACCCCCAGCCAAGGG - Intergenic
1113078164 13:106488854-106488876 CAGGACCACACCCCAGTCAGTGG - Intergenic
1113654483 13:112059152-112059174 GAGGAGCCCCACCCAGACAAAGG - Intergenic
1114394919 14:22349423-22349445 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1116677149 14:47920308-47920330 GAGCCCCCACCCCCAGCCAAGGG - Intergenic
1118478811 14:66143589-66143611 GAGATCCCCTGCCCAGCCAAGGG + Intergenic
1119100767 14:71878306-71878328 GTGGAGCCCACCGCAGCTAAAGG - Intergenic
1120844692 14:89115619-89115641 GAGGACCCCCCCCCTCCTAAGGG + Intergenic
1122413027 14:101535666-101535688 CAGGGCCCCTCCCCAGACAACGG + Intergenic
1122643741 14:103177678-103177700 GAGGACCCCACCCACCCCAGGGG + Intergenic
1122812609 14:104296465-104296487 GGGGACCTCAGCCCAGCCTAGGG - Intergenic
1122826583 14:104373724-104373746 GAAGACCCCACCCCACCCCTGGG - Intergenic
1123189917 14:106559257-106559279 GAGGACTCTACCCCAGGGAAAGG + Intergenic
1124533302 15:30524116-30524138 GGGGATCCCATCCCAGCCCATGG + Intergenic
1124765355 15:32483529-32483551 GGGGATCCCATCCCAGCCCATGG - Intergenic
1125297923 15:38222758-38222780 AAGGACTCCATCACAGCCAAAGG + Intergenic
1125825299 15:42671472-42671494 TACGACCCAACCCCAGCCAATGG - Intronic
1126219692 15:46197929-46197951 GAGCTCCCTTCCCCAGCCAAGGG - Intergenic
1126463262 15:48936467-48936489 GTGGACTCCACCCCAGCAGATGG + Intronic
1127583109 15:60355497-60355519 GACAACTCCACCCCAGACAAAGG + Intronic
1127697226 15:61462151-61462173 GAGGACCCCGCCTCACCCCAGGG - Intergenic
1128856635 15:71023614-71023636 GAGCTCCCACCCCCAGCCAAGGG + Intronic
1129229580 15:74189296-74189318 GAGGGCCCCATCCCAGGAAAGGG + Intronic
1129283666 15:74506246-74506268 GATGCCCCCACCTCAGCCACAGG + Intergenic
1130980137 15:88806718-88806740 GAGGACCTCAGCTGAGCCAAAGG + Intronic
1132169091 15:99629424-99629446 TACGACCCGACCCCAGACAATGG - Intronic
1132254705 15:100365767-100365789 GTGGAGCCCACCACAGCCCAAGG + Intergenic
1132392642 15:101450274-101450296 CAGGACCCCTCTCCAGCCACAGG + Intronic
1132601391 16:774650-774672 GATGCCCCCACCACAGCCAGCGG + Intronic
1132696052 16:1202455-1202477 GAGGACCCAGCCCCACCCCACGG + Intronic
1132891423 16:2206684-2206706 GAGCAGCCCACCCCAGCCCCGGG - Intronic
1133132585 16:3686684-3686706 GAGCCCCCAACCCCAGCCAGAGG - Intronic
1133360921 16:5173227-5173249 GACCACCCCACCCCAACCCATGG - Intergenic
1133388277 16:5388279-5388301 GAAGCCCCCAACCCAACCAAGGG - Intergenic
1133682116 16:8129408-8129430 TGCGACCCCACCCCAGCCAATGG - Intergenic
1135403400 16:22181624-22181646 GAGGCCCTCACCACGGCCAAGGG + Exonic
1136250250 16:28999729-28999751 GAGGACTCCACACCAGCCCCCGG - Intergenic
1136643587 16:31589175-31589197 GAGTGCCCAACCCCATCCAAGGG - Intergenic
1136662022 16:31771635-31771657 GAGTGCCCAACCCCATCCAAGGG + Intronic
1136707781 16:32202929-32202951 GGGGACCCCGCCCCAACCCAGGG + Intergenic
1136760128 16:32726482-32726504 GGGGACCCCGCCCCAACCCAGGG - Intergenic
1136807976 16:33143904-33143926 GGGGACCCCGCCCCAACCCAGGG + Intergenic
1138121201 16:54402163-54402185 GAGGCCCCCACCCCACCCCCAGG - Intergenic
1138201716 16:55093457-55093479 CAGGACCCCACCCTAGACTAAGG + Intergenic
1139151083 16:64382210-64382232 CTGGACCCCACACCTGCCAAGGG - Intergenic
1141400604 16:83743877-83743899 GAGCACACCACCCCAGCCTTAGG + Intronic
1203062284 16_KI270728v1_random:986804-986826 GGGGACCCCGCCCCAACCCAGGG - Intergenic
1142522820 17:517113-517135 GATGCCCCCACCCCAGCCCATGG - Exonic
1142916453 17:3142971-3142993 GAGCTCCCACCCCCAGCCAAGGG - Intergenic
1143715894 17:8768777-8768799 TACAACCCGACCCCAGCCAATGG + Intergenic
1144540416 17:16135870-16135892 TAAGACCCCACCCCAACAAAAGG + Intronic
1145064069 17:19750094-19750116 GGGGAGCCCACCCCAACCCATGG - Intergenic
1146732315 17:35204435-35204457 GTGGAGCCCACCCCAGCTCAAGG - Intergenic
1146894914 17:36534395-36534417 GTGGACGTGACCCCAGCCAAGGG + Intronic
1147851154 17:43443988-43444010 CAGGGCCCCACCCCAGTCAATGG - Intergenic
1147930706 17:43978806-43978828 AGGGGCCCCAACCCAGCCAAGGG - Intronic
1148454694 17:47804792-47804814 GAGGGGCCCACACCAGCCAGGGG - Intergenic
1148465293 17:47861263-47861285 CAGGCCCCCACCCCGGCCAGAGG - Intergenic
1149242253 17:54663715-54663737 GAGCCCCCACCCCCAGCCAAGGG - Intergenic
1149721745 17:58851905-58851927 GTGGAGCCCACCGCAGCCGAAGG - Intronic
1150190579 17:63233452-63233474 GAGCTCCCACCCCCAGCCAAGGG - Intronic
1152710761 17:81869645-81869667 GAGGGCCCCACCCCCACCAGTGG + Intronic
1154355246 18:13619678-13619700 GCCGGCCCCGCCCCAGCCAAGGG - Intronic
1154388768 18:13918756-13918778 CAGGACCCCACCCCAGGCCCTGG + Intergenic
1155117592 18:22784412-22784434 GAGCTCCCACCCCCAGCCAAGGG - Intergenic
1156694668 18:39752899-39752921 GGAGCCCCCACCCCAGCCAAGGG + Intergenic
1160920361 19:1516668-1516690 CTGGAGCCCACCCCAGCCACGGG - Intergenic
1160940322 19:1617781-1617803 GACGGCCCCACCCCAGAGAAGGG - Intronic
1161297210 19:3526156-3526178 AAGGACGCCACCTCAGACAACGG + Exonic
1162069943 19:8147529-8147551 GAGCCCCCCACCCTAGCCATGGG + Intronic
1162374973 19:10299617-10299639 GAGGCCCCCACCCCTGCCCAAGG - Intergenic
1162450595 19:10751994-10752016 TATGACCCGACCCCGGCCAATGG - Intronic
1162692089 19:12441237-12441259 GAGGAAGCCCCCCCTGCCAAGGG - Intronic
1162917422 19:13881806-13881828 GAGGACCCCGCCTGAGCCATGGG + Intergenic
1163469062 19:17486462-17486484 GAGGACCCCAGGGCAGCCAGGGG - Intronic
1163784448 19:19267580-19267602 GAAGACCACACCCCTGCCATGGG - Intronic
1163886261 19:19967259-19967281 GAGCCCCCAGCCCCAGCCAAGGG - Intergenic
1163888204 19:19988225-19988247 GAGCCCCCAACCCCAGCCAAGGG + Intergenic
1164145541 19:22510461-22510483 CAGGACCCCTCCCCATGCAAGGG + Intronic
1165099834 19:33432438-33432460 AAGGAGCCCACCCCACCCCAGGG + Intronic
1165607352 19:37116969-37116991 GTGGAGCCCACCACAGCTAAAGG + Intronic
1165823463 19:38692251-38692273 CAGGACCCAACCCCAGCCAGGGG - Intronic
1166211204 19:41307717-41307739 GAGGCCCCCACCCCAATTAACGG - Intronic
1166655418 19:44607720-44607742 TACGACCCAACCCCAGCCAATGG + Intergenic
1166719765 19:44990279-44990301 GAGGACCCAGCCCCACCCCAGGG + Intronic
1166733274 19:45070459-45070481 GAGGACCTCACCCCAGGTCAAGG + Intronic
1167666060 19:50823346-50823368 GAGGACCCCAACCCTCCCATGGG - Intronic
925377897 2:3401194-3401216 GAGGTCACCAGCCAAGCCAAAGG - Intronic
925385296 2:3457991-3458013 AAGGAGCCCAGCCCAGCCGAAGG + Intronic
927516641 2:23675372-23675394 CAGGACCCCATCCCAGCCCAAGG - Intronic
928757662 2:34545886-34545908 GAACACCCACCCCCAGCCAAGGG - Intergenic
929776801 2:44935182-44935204 GGGGAACCCGGCCCAGCCAAAGG + Intergenic
931800916 2:65756837-65756859 GAGGGCTCCACCCCTGCCACAGG + Intergenic
934476892 2:94599579-94599601 GAGGACCCCGCCCCAGCCAAGGG - Intronic
934779499 2:96960681-96960703 GAAGACCCAACCCCACCCACTGG + Intronic
935281958 2:101526038-101526060 TACAACCCGACCCCAGCCAATGG - Intergenic
937064044 2:119003959-119003981 GTGGAGCCCACCCCAGCTCAAGG - Intergenic
937154658 2:119710502-119710524 CAGGAGCCCACCCCAGACAGAGG + Intergenic
937378013 2:121351101-121351123 GGGAACCCCACCCCAGCATACGG + Intronic
937592323 2:123629215-123629237 GTGGACCCCACCACAGCTCAAGG + Intergenic
938144225 2:128820676-128820698 GAGAGCCCCAGGCCAGCCAATGG + Intergenic
938178801 2:129161518-129161540 CAGGAGCCCACTCCAGCCCAAGG - Intergenic
938628448 2:133137936-133137958 TACGACCCCACCTCAGCCAATGG - Intronic
938638275 2:133252479-133252501 GGGGACCCAGCTCCAGCCAATGG - Intronic
938648722 2:133358002-133358024 GAGGACAACACCCCAGGAAAAGG - Intronic
939398296 2:141660230-141660252 GAGCTCCCACCCCCAGCCAAGGG + Intronic
939470376 2:142613291-142613313 GTGGAGCCCACCACAGCCCAGGG - Intergenic
940400642 2:153244549-153244571 GAGCTCCCTCCCCCAGCCAAGGG + Intergenic
940615796 2:156047587-156047609 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
942742538 2:179196443-179196465 GTGGAGCCCACCACAGCTAAAGG + Intronic
943250835 2:185519136-185519158 GAGCCCCATACCCCAGCCAAGGG - Intergenic
946414853 2:219534912-219534934 GAGGACCCCCCCCCAGTCCCAGG + Intronic
946880805 2:224175657-224175679 GAGGCACCAACACCAGCCAATGG - Intergenic
946919564 2:224564658-224564680 GAAGTCCCCACCCCATCCACAGG - Intronic
947586657 2:231360824-231360846 GGGGACCCCCCGCCAGCCAAGGG + Intronic
1168772565 20:424713-424735 GTGGAGTCCACCCCAGCCAAGGG + Intronic
1169289354 20:4335384-4335406 GAGGTCCCCACTACTGCCAAAGG - Intergenic
1171410470 20:24943649-24943671 CAGGGCCCCACCCCAACCATGGG + Intergenic
1171786637 20:29471778-29471800 GAGGAGCCCACCACAGCTCAAGG - Intergenic
1172643332 20:36455013-36455035 GCGTGCCCCTCCCCAGCCAAAGG + Intronic
1172853460 20:37983375-37983397 GCTGACCCCACCCCGGCCATAGG - Exonic
1173003782 20:39124301-39124323 GATGACCCCCACCCAGCCAGGGG + Intergenic
1174138349 20:48395928-48395950 TACAACCCGACCCCAGCCAATGG + Intergenic
1174992096 20:55522552-55522574 GAGTACATCTCCCCAGCCAAGGG - Intergenic
1175298116 20:57923339-57923361 GGGGACTCCAGCCCAGCCCAGGG - Intergenic
1175728353 20:61334629-61334651 GAGGACCCAACCCCTCCCAAAGG + Intronic
1175770149 20:61618354-61618376 ACGGACCCCATCTCAGCCAAGGG - Intronic
1175809912 20:61852383-61852405 GTGGACATCACCCCATCCAAGGG + Intronic
1176104737 20:63380675-63380697 GTGGACCCCACACCTGCCGAGGG - Intergenic
1177267578 21:18804464-18804486 TATGACCTGACCCCAGCCAATGG + Intergenic
1178909934 21:36666299-36666321 GATAAACCCACCCCATCCAATGG + Intergenic
1179649176 21:42795653-42795675 TAGGACCTGACCCCAGCCAATGG + Intergenic
1180250427 21:46582541-46582563 GAGCTCCCATCCCCAGCCAAGGG - Intergenic
1180419418 22:12799859-12799881 GTGGATCCCACACCTGCCAAGGG - Intergenic
1180854101 22:19035632-19035654 GAGGCTCCCATCCCTGCCAAGGG + Intergenic
1181497836 22:23297958-23297980 GAGCACCCCACCCCATCCCGGGG + Intronic
1181775265 22:25154669-25154691 GAACACCCCACCCCAGGGAAAGG - Intronic
1181896299 22:26110890-26110912 GAGGATCCCACCCAAGCCAGTGG + Intergenic
1183284561 22:36953773-36953795 GAAGACCCCACCCCAGCCCATGG - Intergenic
1183659008 22:39207423-39207445 GGGCACCCCACCCCACCCCATGG + Intergenic
1183741509 22:39671010-39671032 CAGGACCCCACCCCAGGGATAGG + Intronic
1183834835 22:40443756-40443778 TCTGACACCACCCCAGCCAAGGG - Intronic
1184722468 22:46322971-46322993 GGGGACCCCTGCCCAGGCAAAGG - Intronic
1185091627 22:48778821-48778843 GACGACCCCACAGCAGCCAGGGG - Intronic
949356175 3:3182670-3182692 GAGGAGAGCACTCCAGCCAAAGG - Intergenic
949527286 3:4917034-4917056 GTGGAACCCACCACAGCCCAAGG + Intergenic
950226097 3:11235665-11235687 GGGGACGCCACCCCAGCAAGGGG + Intronic
950533642 3:13567257-13567279 GAGGACAGTACCCCAGCCACAGG - Intronic
951101500 3:18693777-18693799 GTGGAGCCCACCACAGCCCAAGG - Intergenic
951330763 3:21365355-21365377 GTGGACCCCACCACAGCTCAAGG + Intergenic
951497785 3:23349744-23349766 GTGGAGCCCACCACAGCCCAAGG + Intronic
951728265 3:25783478-25783500 GAGGACCCCGCCCCTGCCGGTGG - Exonic
952073744 3:29670766-29670788 GTGGAGCCCACCCCAGCTCAAGG + Intronic
954760365 3:52869423-52869445 GAGGGCCCCTCCCACGCCAAGGG - Intronic
955378471 3:58417561-58417583 GAGAATCCCACCCCACCCAATGG - Intronic
956713326 3:72057306-72057328 GACGCCCGCACCCCAGCCAAGGG - Intergenic
957151219 3:76488464-76488486 GAGGACCACACGGCAGGCAACGG - Intronic
957690253 3:83556893-83556915 GAGCTCCCACCCCCAGCCAAGGG - Intergenic
957696898 3:83650385-83650407 GAGCTCCCATCCCCAGCCAAGGG - Intergenic
958166615 3:89885051-89885073 GTGGACCCCACCACAGCTCAAGG - Intergenic
958210551 3:90468503-90468525 GTGGAGCCCACCCCAGCTCAAGG - Intergenic
958651518 3:96942240-96942262 GTGGAGCCCACCACAGCTAAAGG - Intronic
958816980 3:98927691-98927713 GAACCCCCAACCCCAGCCAAGGG + Intergenic
961361731 3:126372496-126372518 GAGGCTCCCACCCCACCCAGAGG + Intergenic
962200317 3:133395876-133395898 GAGCCCCGCTCCCCAGCCAATGG + Exonic
962234456 3:133695214-133695236 GTGGACCCCACCCTAGCCAGAGG + Intergenic
962354686 3:134683855-134683877 GGTGACCCCAACCCAGTCAATGG - Intronic
962777081 3:138671833-138671855 TACAACCCAACCCCAGCCAATGG - Intronic
963773149 3:149409948-149409970 GAAGACCCTCCCCCAGCAAAAGG - Intergenic
965969237 3:174533149-174533171 TATGACCCAACCCCAGCCAATGG + Intronic
967191788 3:186991188-186991210 GAGAACCACACTCCACCCAAGGG - Intronic
968711782 4:2124766-2124788 GAGGACCCCACCCCCAGCAAGGG - Intronic
968747681 4:2369308-2369330 CAGGACCCCACCAAAGCCATGGG + Intronic
969916787 4:10499211-10499233 TAAGACCTGACCCCAGCCAATGG + Intronic
970164907 4:13226422-13226444 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
970712202 4:18876523-18876545 GAGGAAACCCCCCCATCCAAAGG - Intergenic
970982994 4:22123512-22123534 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
972119543 4:35682793-35682815 GAGGAGCCCACCACAGCTCAAGG - Intergenic
973362368 4:49177414-49177436 GTGGATCCCACACCTGCCAAGGG + Intergenic
973369372 4:49233570-49233592 CAGGACCCCGACCCAGCCATGGG - Intergenic
973391665 4:49561846-49561868 CAGGACCCCGACCCAGCCATGGG + Intergenic
973398731 4:49619447-49619469 GTGGATCCCACACCTGCCAAGGG - Intergenic
973546743 4:51990031-51990053 GTGGACCCCACCTCAGCTCAAGG - Intergenic
973640768 4:52900766-52900788 GAGGAGCCCACCACAGCTCAAGG - Intronic
974142084 4:57900111-57900133 GTGGAACCCACCACAGCCCAAGG + Intergenic
974176691 4:58333832-58333854 GTGGAGCCCACCTCAGCTAAAGG + Intergenic
974347167 4:60696908-60696930 GAGCACCTCTCCCCTGCCAAAGG + Intergenic
975798302 4:78032414-78032436 GAGGACACCCCCCCTACCAAGGG + Intergenic
976574756 4:86656850-86656872 GTGGAGCCCACCCCAGCTCAAGG - Intronic
977343693 4:95791882-95791904 GTGGACCCCACCGCAGCTCAAGG + Intergenic
977461933 4:97336997-97337019 GAGCCCCCACCCCCAGCCAAGGG + Intronic
977667014 4:99653768-99653790 GAGGACTCCACCACATCCACAGG - Exonic
978663169 4:111152682-111152704 GTGGAGCCCACCACAGCTAAAGG - Intergenic
978677536 4:111337445-111337467 GTGGAGCCCACCACAGCTAAAGG + Intergenic
979742345 4:124167553-124167575 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
980271968 4:130595571-130595593 ATGGACCCCATCTCAGCCAAGGG - Intergenic
982663261 4:158230211-158230233 GACCCCCACACCCCAGCCAAGGG - Intronic
982800628 4:159702303-159702325 GAGCAGCCCAGCCCAGCTAAAGG - Intergenic
983972354 4:173890348-173890370 GAGCCCCCAACACCAGCCAAGGG - Intergenic
986257253 5:6110676-6110698 TGGGAGCCCACCCAAGCCAACGG - Intergenic
987865333 5:23528716-23528738 TACGACCCGACCCCAGCCAGTGG - Intergenic
988691402 5:33576351-33576373 AAGGACTGCTCCCCAGCCAAAGG - Exonic
988840167 5:35075553-35075575 GTGGAGCCCACCCCAGCTCAAGG + Intronic
990600816 5:57357005-57357027 GCGGAGCCCACCACAGCCCAAGG - Intergenic
991195728 5:63930002-63930024 TACGACCCGACCCCAGCCAATGG - Intergenic
991776933 5:70094403-70094425 GAGTAATCCACCCCAGCTAAAGG - Intergenic
991856219 5:70969848-70969870 GAGTAATCCACCCCAGCTAAAGG - Exonic
991870235 5:71102642-71102664 GAGTAATCCACCCCAGCTAAAGG - Intergenic
992873513 5:81029164-81029186 GTGGAGCCCACCGCAGCCCAAGG + Intronic
993117341 5:83734190-83734212 GAGCCCCCTACGCCAGCCAAGGG - Intergenic
993402616 5:87472532-87472554 GACCACCCTCCCCCAGCCAAGGG + Intergenic
994298021 5:98113952-98113974 GAGGACCCCAACGCAGCTCAAGG + Intergenic
994350622 5:98742292-98742314 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
994813612 5:104556071-104556093 GTAGCCCCCACCCCAGCCAAGGG - Intergenic
995020946 5:107367019-107367041 GAGTAAACCACCCAAGCCAAAGG + Intergenic
995276550 5:110284268-110284290 GTGGACCCCACCACAGCTCAAGG - Intergenic
996054489 5:118968535-118968557 GAAGGCCCTACCCCAGCCAAGGG + Intronic
996468788 5:123835077-123835099 GTGGGACCCACCCCACCCAACGG - Intergenic
997713866 5:136028351-136028373 GAGGACCCCACCCTTCCCCACGG + Intergenic
998261909 5:140638203-140638225 TATGACCCGACCCCGGCCAATGG - Intergenic
999244658 5:150147434-150147456 GCGGCCCCCACCCCAGCCCATGG - Intronic
999366816 5:151028771-151028793 GAAGACGCCACCCCTGCCATGGG - Exonic
999914942 5:156248235-156248257 GAGCCACCCAGCCCAGCCAATGG - Intronic
999938511 5:156515558-156515580 GAGTTCCCGCCCCCAGCCAAAGG + Intronic
1001189956 5:169620554-169620576 GAGGAACCCACCACAGCTCAAGG + Intergenic
1001843874 5:174903980-174904002 GAAACCCCCACCCCAGCCAAGGG + Intergenic
1003016539 6:2472522-2472544 CAGGACCTCACCCCAGACAATGG - Intergenic
1003533584 6:6957072-6957094 GAGGAGCCCACATAAGCCAAGGG + Intergenic
1003927991 6:10895388-10895410 TACGACCCGACCCCGGCCAATGG - Intronic
1004293234 6:14387330-14387352 TATGACCCGACCCCGGCCAATGG - Intergenic
1004413646 6:15404462-15404484 GAGGGCCCTACCTCAGCCATGGG + Intronic
1005193878 6:23259905-23259927 GTGGAGCCCACCGCAGCTAAAGG - Intergenic
1005239198 6:23804544-23804566 GTGGAGCCCACCACAGCCCAAGG + Intergenic
1005346790 6:24898334-24898356 GAGGACCCCAGCTTAGACAATGG - Intronic
1005819081 6:29582342-29582364 GAGGACCGCACCCCAGGAATGGG - Intronic
1005989304 6:30893219-30893241 GAGGGTCCCACCCTAGCCGAGGG - Intronic
1007961963 6:45968095-45968117 GAGGACCCCAGCCTAGTCACAGG + Intronic
1008819029 6:55608970-55608992 GAGGCCCTACCCCCAGCCAAGGG + Intergenic
1009289954 6:61869066-61869088 GAACCCCCCTCCCCAGCCAAGGG - Intronic
1009588764 6:65638763-65638785 TAGGATCCCACGCCGGCCAAGGG - Intronic
1009735136 6:67666799-67666821 GAGGAACCCAGCCCAGCTTATGG - Intergenic
1010411609 6:75568076-75568098 GAGCACCCATCCTCAGCCAAGGG + Intergenic
1011516951 6:88165924-88165946 GAGGCCCCCGCCCGGGCCAAGGG + Exonic
1011538701 6:88406998-88407020 GTGGAGCCCACCACAGCTAAAGG + Intergenic
1011550391 6:88526828-88526850 GTGGACCCCACCACAGCTCAAGG - Intergenic
1014064625 6:117110684-117110706 GGAGCCTCCACCCCAGCCAAGGG + Intergenic
1014164114 6:118204171-118204193 AGGGAGCCCAGCCCAGCCAAGGG + Intronic
1014559411 6:122872287-122872309 GGGGGCCCAACCCCAGCCCAGGG + Intergenic
1014945702 6:127494851-127494873 GAGAACTCCACCCAAGCAAATGG + Intronic
1014979240 6:127926704-127926726 GTGGACCCCACCACAGCTCAAGG + Intergenic
1015179542 6:130346595-130346617 GTGGAGCCCACCACAGCCCAAGG + Intronic
1015247102 6:131086831-131086853 GTGGAGCCCACCACAGCTAAAGG + Intergenic
1017966462 6:159271103-159271125 GAAGACCCCACCCCAGGCTGGGG + Intronic
1018720103 6:166565736-166565758 GAGCACCCCTCCCCAGCCACAGG - Intronic
1018901203 6:168052663-168052685 GAGAACCACACCCCTGCCAGCGG + Intergenic
1019322544 7:422235-422257 CAGGACCCCACCGCGGCCAAAGG + Intergenic
1019359787 7:598842-598864 GAGGACACCACCCCCTCGAATGG + Intronic
1019590288 7:1827428-1827450 GAGGACCCCACACCCGCGACGGG - Intronic
1019746868 7:2705683-2705705 TGGCACCCCACCCCAGCCAGGGG - Intronic
1019899446 7:4008487-4008509 TATGACCCGACCCCGGCCAATGG - Intronic
1021147022 7:17101572-17101594 GAGGACCCAGACCCAGCCACAGG - Intergenic
1022511671 7:30938714-30938736 AGGGACTACACCCCAGCCAAAGG + Intronic
1023809507 7:43901256-43901278 GAAGAGCCCACCCCAGCTCAGGG - Intronic
1024990650 7:55232355-55232377 GGAGCCCCCAACCCAGCCAAGGG - Intronic
1028027603 7:85866474-85866496 GAGCATCCACCCCCAGCCAAGGG + Intergenic
1028200510 7:87955757-87955779 GTGGACCCCACCACAGCTCAAGG - Intronic
1028522920 7:91752437-91752459 GAGCTCCCACCCCCAGCCAAAGG + Intronic
1028665803 7:93342464-93342486 GTGGAGCCCACCACAGCCCAAGG + Intronic
1029197878 7:98819070-98819092 TACGACCCAACCCCGGCCAATGG - Intergenic
1030467814 7:109924710-109924732 GTGGAGCCCACCACAGCCCAAGG - Intergenic
1030692266 7:112547546-112547568 GAACTCCCAACCCCAGCCAAGGG - Intergenic
1031479080 7:122256733-122256755 AAGGATCCCACCTCAGGCAAAGG + Intergenic
1033868317 7:145718879-145718901 GAGCTCCCATCCCCAGCCAAGGG - Intergenic
1035171006 7:157017535-157017557 GAGGAGCCCAGCCCAGTCAAAGG - Intergenic
1035367374 7:158357889-158357911 GAGGGCCCCGGCCAAGCCAAGGG + Intronic
1037676055 8:21051553-21051575 GAGGACCGTAACTCAGCCAAAGG + Intergenic
1037884899 8:22590732-22590754 CAGGAGCCCACACCAGCCACTGG - Intronic
1040410909 8:47153267-47153289 GTGGAGCCCACCACAGCCCAAGG + Intergenic
1040582656 8:48709685-48709707 GCAGACCCCATCCCAGACAACGG - Intergenic
1041337235 8:56800224-56800246 GAGAAACCTACCCCAGCCCAGGG + Intergenic
1041371344 8:57164136-57164158 GTGGACCCCACCACAGCTCAAGG - Intergenic
1041474429 8:58248527-58248549 GAGCTCCCTTCCCCAGCCAAGGG + Intergenic
1042489362 8:69380748-69380770 GAACCCCCAACCCCAGCCAAGGG + Intergenic
1044038687 8:87337696-87337718 GAGCCCCCACCCCCAGCCAAGGG - Intronic
1044135917 8:88585007-88585029 GAGGCCCCACCTCCAGCCAAGGG - Intergenic
1044211648 8:89557844-89557866 GTGGACCCCACCACAGCTCAAGG - Intergenic
1044873843 8:96645296-96645318 GAGGGCCCCAGCCCAGTCAGGGG + Exonic
1045788719 8:105956171-105956193 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1046702630 8:117418563-117418585 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
1048018644 8:130519354-130519376 GAGTACCCCAGCCCACCCCATGG - Intergenic
1048465282 8:134660458-134660480 GTGGGCCCCACCCCAGACACTGG + Intronic
1048796403 8:138153802-138153824 GTGGAGCCCACCACAGCTAAAGG + Intronic
1048970080 8:139640481-139640503 GAGGACCCCAACCCAATCTAGGG - Intronic
1049219565 8:141422675-141422697 GAGGGCCCCAGCCCAGGCCACGG - Intronic
1050393031 9:5167163-5167185 GAGCTCCCTTCCCCAGCCAAGGG + Intronic
1050479920 9:6079010-6079032 TAGGGCCCGACCCCGGCCAATGG + Intergenic
1050540990 9:6670010-6670032 GAGGCTCCCACCCCAGCCAGGGG + Intergenic
1050906478 9:11012296-11012318 AAGGCCCTCTCCCCAGCCAATGG + Intergenic
1051300440 9:15644758-15644780 GTGGAGCCCACCGCAGCCCAAGG + Intronic
1052199697 9:25763703-25763725 GAGCCCCCAACCCCAGACAAGGG + Intergenic
1052478321 9:28990365-28990387 GTGGAGCCCACCACAGCTAAAGG + Intergenic
1052645616 9:31230137-31230159 GTGGAGCCCACCCCAGCTCAAGG - Intergenic
1052853135 9:33390327-33390349 GAGGACCCCGCCCCAGCCAAGGG + Intronic
1053129626 9:35607601-35607623 GGGGAGCCCACCACGGCCAATGG - Exonic
1053477713 9:38394048-38394070 TACGACCTGACCCCAGCCAATGG + Intronic
1053681173 9:40486501-40486523 GAGGACCCCACCCCAGCCAAGGG + Intergenic
1053931162 9:43114825-43114847 GAGGACCCCGCCCCAGCCAAGGG + Intergenic
1054282541 9:63138433-63138455 GAGGACCCCACCCCAGCCAAGGG - Intergenic
1054294260 9:63322016-63322038 GAGGACCCCACCCCAGCCAAGGG + Intergenic
1054392282 9:64626505-64626527 GAGGACCCCACCCCAGCCAAGGG + Intergenic
1054426930 9:65131716-65131738 GAGGACCCCACCCCAGCCAAGGG + Intergenic
1054503445 9:65889824-65889846 GAGGACCCCACCCCAGCCAAGGG - Intronic
1055330514 9:75178326-75178348 TACGACCCAACCCCAGCCAATGG - Intergenic
1056430905 9:86526852-86526874 CTGGAGGCCACCCCAGCCAAGGG + Intergenic
1057077107 9:92143663-92143685 TGGGACCCCTCCCCAGCCCAGGG - Intergenic
1057322336 9:94025973-94025995 GTGGACCCCACCACAGCTCAAGG - Intergenic
1057883169 9:98808377-98808399 GAGGACCCCCCAGCACCCAAAGG + Intronic
1058779410 9:108318201-108318223 GATGGCACAACCCCAGCCAAGGG + Intergenic
1058975550 9:110122500-110122522 GAGGGGCAGACCCCAGCCAATGG - Intronic
1059004291 9:110384258-110384280 GAGCTCCCACCCCCAGCCAAAGG - Intronic
1060035793 9:120254532-120254554 GAGGAGCCCATGCCAGCCCAGGG + Intergenic
1060317204 9:122523387-122523409 TTCCACCCCACCCCAGCCAATGG - Intergenic
1060792315 9:126494859-126494881 GAGCACCCCACCCCCCCCCAGGG + Intronic
1060895011 9:127211795-127211817 GAGGAGCCCACGCCAGCCCCAGG + Intronic
1062070538 9:134552920-134552942 AGGGACCCCACCCGAGGCAAAGG - Intergenic
1062138320 9:134941569-134941591 GTGGACCCCACCCCAGCTGCAGG + Intergenic
1062186917 9:135223201-135223223 CAGGCCCCCACCCCAACCCAGGG + Intergenic
1062198814 9:135289803-135289825 GGGGAGCCCAGCCCAGCCACAGG + Intergenic
1062393272 9:136342491-136342513 GAGGACCCTTCCCCAGCCCTGGG - Intronic
1062468528 9:136692060-136692082 GAGGTCCCAACCCCAGCAAGCGG + Intergenic
1062628203 9:137452461-137452483 GCGGCCCCCACCCCAGCCCCAGG + Intronic
1203408100 Un_KI270538v1:66399-66421 GCGGAGCCCACCACAGCCCAAGG + Intergenic
1186702532 X:12106915-12106937 GTGGACCCCACCGCAGCTCAAGG + Intergenic
1186905795 X:14109454-14109476 GTGGAGCCCACCACAGCTAAAGG - Intergenic
1188590081 X:31823056-31823078 TACGACCCAACCCCAGCCAATGG + Intronic
1189323343 X:40098767-40098789 GAAAACACCACCCCAGGCAACGG + Intronic
1189372364 X:40438938-40438960 TACGACCCGACCCAAGCCAATGG - Intergenic
1190062043 X:47218028-47218050 GGAGACCCCACCCCCGCCGACGG + Intronic
1190360437 X:49644175-49644197 CTGGACCCCACACCTGCCAAGGG + Intergenic
1190660463 X:52649582-52649604 GAAGCCCCCATCCCAGCCCAGGG - Intronic
1191092340 X:56636510-56636532 GTGGAGCCCACCACAGCCCAAGG + Intergenic
1191768924 X:64733595-64733617 GAAGGACCCACCCCTGCCAAGGG - Intergenic
1192683737 X:73281866-73281888 GTGGAGCCCACCCCAGCCCAAGG + Intergenic
1192906826 X:75560657-75560679 GTGGAGCCCACCACAGCCCAAGG - Intergenic
1192971234 X:76233554-76233576 GAGCTCCCTCCCCCAGCCAAGGG + Intergenic
1193367367 X:80651079-80651101 GTGGAGCCCACCACAGCCCAAGG + Intergenic
1193457978 X:81754787-81754809 GAGCCCCCATCCCCAGCCAAGGG + Intergenic
1193514323 X:82445502-82445524 GACCACCCTTCCCCAGCCAAGGG + Intergenic
1193871575 X:86805115-86805137 GAGGGCTCCACCCCTGCCACAGG + Intronic
1193884659 X:86970124-86970146 GTGGAGCCCACCACAGCTAAAGG + Intergenic
1194264093 X:91734086-91734108 GAGCCCCCAACCCCAGCCAAGGG - Intergenic
1194302467 X:92204814-92204836 GAGGCCCCCTTCCCAGCCATGGG - Intronic
1194636453 X:96350418-96350440 GAGCACCTCACCCCCTCCAAAGG - Intergenic
1195440706 X:104895410-104895432 GTGGAGCCCACCACAGCTAAAGG - Intronic
1195812587 X:108851122-108851144 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
1196167878 X:112555395-112555417 GAGCTCCCACCCCCAGCCAAGGG + Intergenic
1196252590 X:113479772-113479794 GTGGAGCCCACCACAGCTAAAGG + Intergenic
1196473221 X:116052406-116052428 GTGGACCCCACCACAGCTCAAGG - Intergenic
1197180754 X:123533602-123533624 GAACCCCCAACCCCAGCCAAGGG - Intergenic
1197424106 X:126273446-126273468 GAGCTCCCACCCCCAGCCAAGGG - Intergenic
1197489467 X:127100329-127100351 GTAGCCCCCACCCCAGCCAAGGG + Intergenic
1198127383 X:133659369-133659391 GCGGACCCCACCCTAGAAAATGG - Intronic
1198864316 X:141105279-141105301 TATGACCCGACCCCAGCCAATGG + Intergenic
1198898373 X:141482137-141482159 TATGACCCGACCCCAGCCAATGG - Intergenic
1199481717 X:148305342-148305364 GTGGAGCCCACCACAGCCCAAGG - Intergenic
1199486360 X:148352524-148352546 GTGGAGCCCACCACAGCCCAAGG - Intergenic
1199584875 X:149404525-149404547 GAGGACCAGACCCCAGCAACTGG + Intergenic
1199838755 X:151621988-151622010 GAATTCCCGACCCCAGCCAATGG - Intronic
1199894869 X:152119044-152119066 GAGGCCCCCACCCCAGATAGAGG - Intergenic
1200232192 X:154449627-154449649 GAGGACAGCACCCCTGCCCAGGG - Intronic
1201437205 Y:13972164-13972186 GTGGAGCCCACCACAGCTAAAGG - Intergenic
1201441466 Y:14013027-14013049 GCGGACCCCACCACAGCTCAAGG + Intergenic
1201443104 Y:14029680-14029702 GCGGACCCCACCACAGCTCAAGG - Intergenic
1201614856 Y:15885933-15885955 GTGGAGCCCACCACAGCCCAAGG + Intergenic
1201684313 Y:16683706-16683728 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1202081952 Y:21092770-21092792 GAGTCCCCTCCCCCAGCCAAGGG + Intergenic
1202170799 Y:22041424-22041446 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1202220564 Y:22544949-22544971 GTGGAGCCCACCCCAGCTCAAGG - Intergenic
1202322549 Y:23650714-23650736 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1202356697 Y:24059127-24059149 GTGGAGCCCACCCCAGCTCAAGG + Intergenic
1202514081 Y:25610983-25611005 GTGGAGCCCACCCCAGCTCAAGG - Intergenic
1202548224 Y:26019342-26019364 GTGGAGCCCACCCCAGCTCAAGG - Intergenic