ID: 1054282543

View in Genome Browser
Species Human (GRCh38)
Location 9:63138443-63138465
Sequence GGGTGGGGTCCTCTCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282527_1054282543 18 Left 1054282527 9:63138402-63138424 CCCATTAACCACCCGTCTATCCA No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282528_1054282543 17 Left 1054282528 9:63138403-63138425 CCATTAACCACCCGTCTATCCAC No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282526_1054282543 23 Left 1054282526 9:63138397-63138419 CCAGACCCATTAACCACCCGTCT No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282534_1054282543 -2 Left 1054282534 9:63138422-63138444 CCACATATCACCCCTTGGCTGGG 0: 9
1: 0
2: 1
3: 15
4: 197
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282531_1054282543 6 Left 1054282531 9:63138414-63138436 CCGTCTATCCACATATCACCCCT No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282530_1054282543 7 Left 1054282530 9:63138413-63138435 CCCGTCTATCCACATATCACCCC No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282529_1054282543 10 Left 1054282529 9:63138410-63138432 CCACCCGTCTATCCACATATCAC No data
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data
1054282525_1054282543 26 Left 1054282525 9:63138394-63138416 CCACCAGACCCATTAACCACCCG 0: 7
1: 2
2: 1
3: 10
4: 80
Right 1054282543 9:63138443-63138465 GGGTGGGGTCCTCTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282543 Original CRISPR GGGTGGGGTCCTCTCTTTCC TGG Intergenic
No off target data available for this crispr