ID: 1054282944

View in Genome Browser
Species Human (GRCh38)
Location 9:63141018-63141040
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 8, 1: 0, 2: 2, 3: 23, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054282944_1054282951 -7 Left 1054282944 9:63141018-63141040 CCCCAAAACTTCAGGTGGGCCTG 0: 8
1: 0
2: 2
3: 23
4: 173
Right 1054282951 9:63141034-63141056 GGGCCTGGGGCTGAGGTGCTTGG 0: 8
1: 0
2: 3
3: 100
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054282944 Original CRISPR CAGGCCCACCTGAAGTTTTG GGG (reversed) Intergenic
901712508 1:11126746-11126768 CCGGCACATCAGAAGTTTTGGGG + Exonic
903184487 1:21621709-21621731 CATGCCCAGCTGAGGTTGTGTGG - Intronic
903707609 1:25298423-25298445 CAGGCTGAATTGAAGTTTTGAGG - Intronic
903719632 1:25394931-25394953 CAGGCTGAATTGAAGTTTTGAGG + Intronic
904106745 1:28090962-28090984 TGGGCCTACCTGTAGTTTTGAGG - Intergenic
905708993 1:40085074-40085096 CAGGCCCGCCTGCAGTTATCCGG + Intronic
908431017 1:64057614-64057636 CAGGCCCACCCAAACTATTGAGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909355479 1:74703945-74703967 GAGGCCCACCTGCATTATTGAGG - Intergenic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
912796588 1:112697118-112697140 CAGTCCCAGATGAAGTTTTCAGG + Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918510907 1:185313477-185313499 CCCGCCCACCTCAAGTTTGGAGG + Intronic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
920541734 1:206783947-206783969 CCAGCCCACCTGAAGTGTAGTGG + Intergenic
922080344 1:222289694-222289716 CAGACTAACCTGATGTTTTGTGG - Intergenic
922175277 1:223192689-223192711 CAGGGCCACCTAAGGTTTTAGGG + Intergenic
924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG + Intronic
1063217334 10:3936673-3936695 CAGGCCCACCTCCAGCATTGGGG - Intergenic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG + Intergenic
1066684959 10:37972514-37972536 TAGGCCCAGCCCAAGTTTTGAGG - Intronic
1068717053 10:60200171-60200193 CCGGCCAAGCTGAAGTTGTGCGG - Exonic
1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG + Intronic
1069861037 10:71471984-71472006 CAGGCACACCTGTAGATGTGGGG - Intronic
1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG + Intronic
1070537178 10:77388321-77388343 CAGCCCCACCAGGAGCTTTGTGG - Intronic
1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG + Intergenic
1073095750 10:100978723-100978745 CAGGCTCACCTGGGGATTTGGGG - Intronic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1077400175 11:2351741-2351763 CAGGACCACCTGGAGACTTGGGG - Intergenic
1080587512 11:33695118-33695140 CTGGCCAGCCTGAAGTTTTCTGG + Intergenic
1083145653 11:60756549-60756571 CAGCCACACCTAAAGTGTTGGGG + Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1090674917 11:128982998-128983020 TAGGCCCATCTGAATCTTTGTGG - Intronic
1091461164 12:644229-644251 CAGGCCCACATTTAGGTTTGAGG - Intronic
1093242703 12:16697552-16697574 CAGGGCTGTCTGAAGTTTTGGGG + Intergenic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1097522867 12:60690068-60690090 CAGGCACACATGAAGTCCTGAGG - Intergenic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1105876139 13:24555037-24555059 CAGGCCCACCCGCAGTTATCTGG - Intergenic
1106539532 13:30677484-30677506 CAGGCCCTGCTGCAGTGTTGGGG - Intergenic
1113775395 13:112942126-112942148 CAGGCCCACCCGCAGTTATCTGG + Intronic
1115821279 14:37214948-37214970 CAGGCCCACCCGCAGTTATCCGG + Intronic
1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG + Intergenic
1117431134 14:55662828-55662850 CAAGTTCACCTCAAGTTTTGTGG - Intronic
1118410879 14:65476284-65476306 CAGGCCTCCCTGAAGTTTAGGGG - Intronic
1118810145 14:69267201-69267223 AAGGCGCATCTGAAGTTTAGGGG - Intronic
1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG + Intergenic
1121881355 14:97503171-97503193 CAGGACCACCAGGAGTGTTGGGG + Intergenic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1124509417 15:30310354-30310376 TAGGCCCACCTGGATTTTGGTGG - Intergenic
1124734142 15:32228308-32228330 TAGGCCCACCTGGATTTTGGTGG + Intergenic
1124877334 15:33607370-33607392 CAGGCCCACCTGAAGTGCCCAGG - Intronic
1125462139 15:39917630-39917652 CAAGCCCAGCTGAACTTTTAAGG + Intronic
1125579516 15:40775544-40775566 CAGGCTCACCTTTAGTTTGGGGG + Exonic
1126061220 15:44784670-44784692 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1126254018 15:46603559-46603581 CAGAACCACCTGGAGTTATGTGG - Intergenic
1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG + Intergenic
1129921127 15:79319972-79319994 CAGGCCCACCCGCAGTTATCCGG - Intronic
1130850813 15:87791953-87791975 CAGGCATTCCTGAACTTTTGGGG - Intergenic
1131450588 15:92536208-92536230 GAGACCCACCTGAAATTTTCAGG + Intergenic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136882946 16:33913965-33913987 CTGGCCCCACTGAGGTTTTGGGG - Intergenic
1140522850 16:75597121-75597143 CAGGTAGACATGAAGTTTTGGGG - Intronic
1140610030 16:76587209-76587231 CAGGCTTAAGTGAAGTTTTGAGG + Intronic
1140966612 16:79972517-79972539 CAGGCCATCCTGATGCTTTGGGG - Intergenic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1144410243 17:14993894-14993916 CAGGCCCCCATGGAATTTTGGGG - Intergenic
1144483355 17:15645403-15645425 CAGGCAAACCTGAGGTTTTTGGG - Intronic
1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG + Intronic
1146054411 17:29574007-29574029 CTGGTCCATCTGGAGTTTTGAGG - Exonic
1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG + Intronic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1152378477 17:79930387-79930409 CCGGCCCACCTGAGGCCTTGGGG - Intergenic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1153608960 18:6862359-6862381 CGGGGCCCCCTGAAGTCTTGGGG - Intronic
1156001737 18:32392587-32392609 CATGACCCCCTGAAGTTCTGAGG + Intronic
1158110150 18:53931767-53931789 AAGGACCACCTGATGTTATGAGG - Intergenic
1160354607 18:78216379-78216401 CAGGGCCGCCTGAACATTTGTGG + Intergenic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG + Intergenic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1168603399 19:57738701-57738723 CAGGCCCACCCGCAGTTATCCGG + Intronic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
930115717 2:47716700-47716722 CAGGCCCACCCGCAGTTATCCGG + Intronic
930466726 2:51762153-51762175 CAAGGCCAACTGCAGTTTTGAGG + Intergenic
931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG + Intergenic
938465751 2:131523806-131523828 CATGCCCATCTGAGGTTTTCGGG - Intergenic
939122955 2:138140390-138140412 CAGGCACACCTAAAGTGCTGAGG + Intergenic
940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG + Intronic
940987797 2:160065738-160065760 GAGGCCCATCTCAAATTTTGGGG - Intergenic
942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG + Intronic
944671112 2:201995408-201995430 CTGGCCCACCTGAGCTCTTGGGG - Intergenic
947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG + Exonic
947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG + Intronic
947855455 2:233320759-233320781 CAGGCTCTCTTGCAGTTTTGTGG - Exonic
1173734620 20:45350530-45350552 TAGGCCCCCCTGCAATTTTGTGG - Intergenic
1176063806 20:63183818-63183840 CAGGCCCACCTGGACCTTGGTGG - Intergenic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1176431321 21:6578173-6578195 CAGGCCTCCCTGAAAGTTTGGGG - Intergenic
1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG + Intronic
1179706715 21:43185635-43185657 CAGGCCTCCCTGAAAGTTTGGGG - Intergenic
1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG + Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
1185244453 22:49765735-49765757 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244475 22:49765806-49765828 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244497 22:49765877-49765899 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244516 22:49765948-49765970 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244540 22:49766019-49766041 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG + Intronic
953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG + Intergenic
953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG + Intronic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
953607950 3:44424174-44424196 CAGGCACACTTCCAGTTTTGGGG - Intergenic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG + Intergenic
961623015 3:128239539-128239561 GAAGCCCACCTCAAGTTCTGAGG - Intronic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG + Intronic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
968350909 3:198051172-198051194 CAGGCCCACCCGCAGTTATCCGG + Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG + Intronic
969961508 4:10948999-10949021 TAGGCCCACCTAAATTATTGAGG - Intergenic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
983702422 4:170614482-170614504 CAGGGCTTCCTGAAGCTTTGTGG - Intergenic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
988704747 5:33714003-33714025 CAAGCCCACATGAAGATTTCAGG - Intronic
991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG + Intergenic
996564001 5:124860624-124860646 CAGGTCAACATCAAGTTTTGTGG + Intergenic
996676773 5:126184415-126184437 CAGGCCCATGTAAAGTGTTGGGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1002517712 5:179772041-179772063 CAGACCCATCTGACATTTTGTGG + Intronic
1002550841 5:179990503-179990525 CAGGCCCACCCGCAGTTATCTGG - Intronic
1002944442 6:1747701-1747723 CAGGACCTCCAGTAGTTTTGTGG + Intronic
1005437357 6:25829105-25829127 AAGGCCCAACTTATGTTTTGAGG - Intronic
1012747698 6:103115684-103115706 CAGGCCCATCTCTAATTTTGGGG - Intergenic
1014747889 6:125221252-125221274 CAGACCCAGCTAAAGATTTGAGG - Intronic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1015936135 6:138407490-138407512 CAGGGCCACTTGAAGCCTTGGGG - Intronic
1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG + Intergenic
1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG + Intronic
1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG + Intergenic
1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG + Intergenic
1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG + Exonic
1035324374 7:158055477-158055499 CAGGCCCACCCGCAGTTATCCGG + Intronic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1041632964 8:60108817-60108839 CAGGCACACACTAAGTTTTGTGG - Intergenic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG + Intronic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG + Intronic
1049881355 8:145066302-145066324 CAGGCCCACCCGCAGTTATCCGG + Intergenic
1052799532 9:32955495-32955517 CAGCCCCACTAGAAGCTTTGAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1055673595 9:78632240-78632262 TGGGCCCACTTGAACTTTTGCGG - Intergenic
1056581681 9:87891145-87891167 CGGGCCCACCAGAAGCTTTCAGG - Intergenic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1059092449 9:111374346-111374368 CAGGCACACCTGAAGATATTTGG - Intronic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1061682975 9:132252571-132252593 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1062482952 9:136760840-136760862 CAGGTGGGCCTGAAGTTTTGGGG - Intronic
1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG + Intergenic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1189717539 X:43881753-43881775 CAGGCCCTCCTGATTCTTTGAGG - Intronic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1192606833 X:72527321-72527343 CAGGCCTTTCTGAAGTATTGAGG - Intronic
1195640999 X:107174617-107174639 AAGGGCCAGCTGTAGTTTTGGGG - Intronic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1198512857 X:137371670-137371692 CAGGAGAACGTGAAGTTTTGGGG + Intergenic
1198998671 X:142606666-142606688 CAGGTCCACCCGAAGTTGTCCGG - Intergenic
1199963323 X:152796958-152796980 CAGGCCCAACTCAACTGTTGCGG + Intergenic