ID: 1054286503

View in Genome Browser
Species Human (GRCh38)
Location 9:63179886-63179908
Sequence TCATTTCCACACAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054286499_1054286503 20 Left 1054286499 9:63179843-63179865 CCCCTCACCATTGAAAACACATT No data
Right 1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG No data
1054286502_1054286503 13 Left 1054286502 9:63179850-63179872 CCATTGAAAACACATTAACTGAC No data
Right 1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG No data
1054286500_1054286503 19 Left 1054286500 9:63179844-63179866 CCCTCACCATTGAAAACACATTA No data
Right 1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG No data
1054286501_1054286503 18 Left 1054286501 9:63179845-63179867 CCTCACCATTGAAAACACATTAA No data
Right 1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054286503 Original CRISPR TCATTTCCACACAAAGAAGA TGG Intergenic
No off target data available for this crispr