ID: 1054294273

View in Genome Browser
Species Human (GRCh38)
Location 9:63322046-63322068
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 6, 1: 3, 2: 2, 3: 5, 4: 58}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054294257_1054294273 20 Left 1054294257 9:63322003-63322025 CCTCCAGGAAGGAGAGGACCCCA No data
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294262_1054294273 2 Left 1054294262 9:63322021-63322043 CCCCACCCCAGCCAAGGGGTGAT No data
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294264_1054294273 0 Left 1054294264 9:63322023-63322045 CCACCCCAGCCAAGGGGTGATAT 0: 9
1: 0
2: 1
3: 8
4: 176
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294258_1054294273 17 Left 1054294258 9:63322006-63322028 CCAGGAAGGAGAGGACCCCACCC No data
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294269_1054294273 -9 Left 1054294269 9:63322032-63322054 CCAAGGGGTGATATGTGGATACA 0: 7
1: 2
2: 0
3: 3
4: 114
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294263_1054294273 1 Left 1054294263 9:63322022-63322044 CCCACCCCAGCCAAGGGGTGATA No data
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294265_1054294273 -3 Left 1054294265 9:63322026-63322048 CCCCAGCCAAGGGGTGATATGTG 0: 9
1: 0
2: 0
3: 8
4: 119
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294266_1054294273 -4 Left 1054294266 9:63322027-63322049 CCCAGCCAAGGGGTGATATGTGG 0: 9
1: 0
2: 0
3: 6
4: 118
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58
1054294268_1054294273 -5 Left 1054294268 9:63322028-63322050 CCAGCCAAGGGGTGATATGTGGA 0: 9
1: 0
2: 0
3: 2
4: 80
Right 1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG 0: 6
1: 3
2: 2
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054294273 Original CRISPR GTGGATACACGGGTGGTTAA CGG Intergenic
903028139 1:20443964-20443986 GTGCATGCACTGGTGGATAAGGG - Intergenic
914331090 1:146671390-146671412 GTGGGGCCATGGGTGGTTAAGGG + Intergenic
915616451 1:157043283-157043305 CTGGATAGATGGGTGGTTGAAGG - Intronic
922679829 1:227584335-227584357 GTGGATAAACGGTTCGTTTAAGG - Intronic
924564515 1:245185664-245185686 GTGAATAAACTGGTGGTAAATGG - Intronic
1079852209 11:25549227-25549249 GTAGATCCAAGGGTGGTTCATGG - Intergenic
1082872757 11:57958754-57958776 ATGGATATATGGGTTGTTAATGG + Intergenic
1089565931 11:119371786-119371808 GTGGATACACGGGTAGATGGCGG - Intronic
1094747935 12:33368148-33368170 GTGGATACACCTGTAGTTAACGG - Intergenic
1101877522 12:108605698-108605720 GTGGTTAGATGGGTGGTTAGTGG + Intergenic
1101877543 12:108605796-108605818 GTGGTTAGATGGGTGGTTAGTGG + Intergenic
1101877554 12:108605852-108605874 GTGGTTAGATGGGTGGTTAGTGG + Intergenic
1101877567 12:108605916-108605938 GTGGTTAGATGGGTGGTTAGTGG + Intergenic
1104092295 12:125526939-125526961 GTGGATAGAAGGGTGGTGGATGG - Intronic
1106692636 13:32134621-32134643 GTGGATACACGTGTGCTTGCTGG + Intronic
1111008167 13:82276537-82276559 GTGGATACACAGGGAGTTAGGGG + Intergenic
1119001477 14:70885875-70885897 GGGGATACACAGATGGTTACAGG + Intergenic
1121943457 14:98095344-98095366 GAGGAAACATGGGTAGTTAATGG + Intergenic
1122958403 14:105083401-105083423 GTGGATAGACGGGTGGATGGAGG - Intergenic
1132762393 16:1516332-1516354 GTGGGGACACGGGTGGGAAATGG + Intronic
1133377495 16:5299827-5299849 GTGGATACAAGTGGGGATAATGG + Intergenic
1133517521 16:6524114-6524136 GAGGAAATAAGGGTGGTTAATGG - Intronic
1140002463 16:71039514-71039536 GTGGGGCCATGGGTGGTTAAGGG - Intronic
1140609277 16:76578637-76578659 GTGGAGGCAGGGATGGTTAATGG + Intronic
1145116910 17:20218774-20218796 GTGGAAACAGGGATGGTTAATGG - Intronic
1149090332 17:52770371-52770393 GTGGAGAGACATGTGGTTAAAGG - Intergenic
1156387952 18:36623809-36623831 GTGGATACACTCCTGGTAAACGG + Intronic
1158187134 18:54783640-54783662 GAGGATGCACGGGTGTCTAATGG + Intronic
1160214545 18:76916833-76916855 GTGGAGACAGGGGTGCTAAATGG + Intronic
1162791824 19:13066960-13066982 GTGGATAGATGGGGGGCTAAGGG - Intronic
1163383606 19:16985538-16985560 GTGGATAGATGGGTGGAGAAAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
927655700 2:24943593-24943615 GTGGAAACACTGGTCTTTAATGG - Intergenic
930236556 2:48894452-48894474 GTGGGTGCATAGGTGGTTAAGGG - Intergenic
934476879 2:94599549-94599571 GTGGATACACGGGTGGTTAATGG - Intronic
939859327 2:147398532-147398554 GTGGCCACACTGCTGGTTAATGG + Intergenic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
946273880 2:218616086-218616108 GTGGATACATGGGTGGATAGAGG + Intronic
948068424 2:235100336-235100358 GTGGATACACAGGTGCATAAAGG - Intergenic
1175613602 20:60373171-60373193 GTGGTTACCCAGGTAGTTAATGG + Intergenic
1177684871 21:24422886-24422908 GTGGGTACAGAGGTGGCTAAAGG - Intergenic
1178679096 21:34657116-34657138 GTGGATGGATGGGTGGATAATGG + Intergenic
1182284078 22:29233741-29233763 ATGGATACAAGGGTGGATGATGG - Intronic
1183321888 22:37169940-37169962 GTGGATAGAAGGGTGGTTAATGG + Intronic
960870455 3:122244047-122244069 GAGGAAGCAGGGGTGGTTAATGG + Intronic
963286879 3:143442034-143442056 GTGGATGGATGGGTAGTTAAGGG - Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
966338023 3:178892522-178892544 AGGGATACAGGGATGGTTAATGG + Intergenic
966338085 3:178893301-178893323 GGGGATACACGGATGGTTAATGG + Intergenic
968170062 3:196503075-196503097 GTGGTTACACGGGAGGGTGACGG + Exonic
968594520 4:1475443-1475465 GTGGATAGATGGGTGGGGAATGG + Intergenic
977665827 4:99646414-99646436 ATGGAAACACAGATGGTTAATGG + Intronic
980693097 4:136320953-136320975 GTGGATACACAGGTGCTTGAAGG + Intergenic
986887953 5:12263261-12263283 GTGGATAAAGGGGTTGTTATTGG + Intergenic
996618614 5:125472236-125472258 GTGAATATAGAGGTGGTTAATGG - Intergenic
1008641486 6:53467170-53467192 GTGGAAATAGGGATGGTTAATGG - Intergenic
1031317838 7:120278951-120278973 GTGGATAAAAGGGTGATTCAGGG - Intronic
1032656033 7:133930648-133930670 GGGGATACACGGGGAGTTAGTGG - Intronic
1048454736 8:134567502-134567524 GTGGATAGATGGGTGGATTATGG - Intronic
1052853148 9:33390357-33390379 GTGGATACATGGGTGGTTAATGG + Intronic
1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG + Intergenic
1053931175 9:43114855-43114877 GTGGATACACGGGTGGTTAATGG + Intergenic
1054282528 9:63138403-63138425 GTGGATAGACGGGTGGTTAATGG - Intergenic
1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG + Intergenic
1054392295 9:64626535-64626557 GTGGATACACGGGTGGTTAATGG + Intergenic
1054426943 9:65131746-65131768 GTGGATACACGGGTGGTTAATGG + Intergenic
1054503432 9:65889794-65889816 GTGGATACACGGGTGGTTAATGG - Intronic
1061050597 9:128192463-128192485 GGGGATACAGCGGTTGTTAAGGG - Intronic
1062286461 9:135775132-135775154 GCTGATGCACAGGTGGTTAAGGG + Intronic
1185581128 X:1212156-1212178 GTGGATGGATGGGTGATTAATGG + Intronic
1189003468 X:36970317-36970339 GTTGATACACGGGTGGGAATAGG - Intergenic
1190240839 X:48656801-48656823 GTAGAAATATGGGTGGTTAAAGG - Intergenic
1195480056 X:105334379-105334401 GTGGAGGCAGGGATGGTTAATGG + Intronic
1199114150 X:143970242-143970264 GTGGAGGCAGGGATGGTTAACGG - Intergenic