ID: 1054297756

View in Genome Browser
Species Human (GRCh38)
Location 9:63345846-63345868
Sequence CTTTCTGGGCAGAGGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054297741_1054297756 19 Left 1054297741 9:63345804-63345826 CCCTCTGTCTTCCTGTAACTCTT No data
Right 1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG No data
1054297746_1054297756 -8 Left 1054297746 9:63345831-63345853 CCTGGCCCCTGTGCCCTTTCTGG No data
Right 1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG No data
1054297745_1054297756 -7 Left 1054297745 9:63345830-63345852 CCCTGGCCCCTGTGCCCTTTCTG No data
Right 1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG No data
1054297742_1054297756 18 Left 1054297742 9:63345805-63345827 CCTCTGTCTTCCTGTAACTCTTT No data
Right 1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG No data
1054297744_1054297756 8 Left 1054297744 9:63345815-63345837 CCTGTAACTCTTTCACCCTGGCC No data
Right 1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG No data
1054297740_1054297756 23 Left 1054297740 9:63345800-63345822 CCTTCCCTCTGTCTTCCTGTAAC 0: 9
1: 0
2: 2
3: 60
4: 583
Right 1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054297756 Original CRISPR CTTTCTGGGCAGAGGGTGAC AGG Intergenic
No off target data available for this crispr