ID: 1054303405

View in Genome Browser
Species Human (GRCh38)
Location 9:63392986-63393008
Sequence GACACCTCCAAGTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054303405_1054303408 7 Left 1054303405 9:63392986-63393008 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1054303408 9:63393016-63393038 GATTTGCCCTGCCCCAACGTTGG No data
1054303405_1054303414 23 Left 1054303405 9:63392986-63393008 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1054303414 9:63393032-63393054 ACGTTGGCCCAGCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054303405 Original CRISPR GACACCTCCAAGTCCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr