ID: 1054307166

View in Genome Browser
Species Human (GRCh38)
Location 9:63438435-63438457
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054307159_1054307166 11 Left 1054307159 9:63438401-63438423 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data
1054307161_1054307166 7 Left 1054307161 9:63438405-63438427 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data
1054307157_1054307166 18 Left 1054307157 9:63438394-63438416 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data
1054307160_1054307166 8 Left 1054307160 9:63438404-63438426 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data
1054307158_1054307166 17 Left 1054307158 9:63438395-63438417 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data
1054307156_1054307166 23 Left 1054307156 9:63438389-63438411 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data
1054307163_1054307166 3 Left 1054307163 9:63438409-63438431 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054307166 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr