ID: 1054307207

View in Genome Browser
Species Human (GRCh38)
Location 9:63438751-63438773
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054307204_1054307207 14 Left 1054307204 9:63438714-63438736 CCAGTATAGGACAAGAGCTGTCT No data
Right 1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG No data
1054307203_1054307207 15 Left 1054307203 9:63438713-63438735 CCCAGTATAGGACAAGAGCTGTC No data
Right 1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG No data
1054307202_1054307207 24 Left 1054307202 9:63438704-63438726 CCACAAAAGCCCAGTATAGGACA No data
Right 1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054307207 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr