ID: 1054309457

View in Genome Browser
Species Human (GRCh38)
Location 9:63457884-63457906
Sequence GCCTTGTAATACGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054309454_1054309457 -1 Left 1054309454 9:63457862-63457884 CCAGGATGGTCTCGATCTCCTGG 0: 389
1: 53730
2: 75466
3: 152867
4: 231362
Right 1054309457 9:63457884-63457906 GCCTTGTAATACGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054309457 Original CRISPR GCCTTGTAATACGCCCGCCT TGG Intergenic
No off target data available for this crispr