ID: 1054313534

View in Genome Browser
Species Human (GRCh38)
Location 9:63556258-63556280
Sequence GCATGCAGGTGAGCAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054313528_1054313534 16 Left 1054313528 9:63556219-63556241 CCACTCTGACCTGCTGTGTTCCA No data
Right 1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG No data
1054313527_1054313534 17 Left 1054313527 9:63556218-63556240 CCCACTCTGACCTGCTGTGTTCC No data
Right 1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG No data
1054313531_1054313534 -4 Left 1054313531 9:63556239-63556261 CCACATCTTGCAGGAGAGAGCAT No data
Right 1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG No data
1054313529_1054313534 7 Left 1054313529 9:63556228-63556250 CCTGCTGTGTTCCACATCTTGCA No data
Right 1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054313534 Original CRISPR GCATGCAGGTGAGCAGGCAC AGG Intergenic
No off target data available for this crispr