ID: 1054314918

View in Genome Browser
Species Human (GRCh38)
Location 9:63572311-63572333
Sequence TCTTATGTAAGATTAACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054314913_1054314918 11 Left 1054314913 9:63572277-63572299 CCCATTTTTCTTTTGTTAGCCAT No data
Right 1054314918 9:63572311-63572333 TCTTATGTAAGATTAACTTATGG No data
1054314914_1054314918 10 Left 1054314914 9:63572278-63572300 CCATTTTTCTTTTGTTAGCCATT No data
Right 1054314918 9:63572311-63572333 TCTTATGTAAGATTAACTTATGG No data
1054314915_1054314918 -8 Left 1054314915 9:63572296-63572318 CCATTGCCTTCTTCCTCTTATGT No data
Right 1054314918 9:63572311-63572333 TCTTATGTAAGATTAACTTATGG No data
1054314912_1054314918 20 Left 1054314912 9:63572268-63572290 CCAAACAAGCCCATTTTTCTTTT No data
Right 1054314918 9:63572311-63572333 TCTTATGTAAGATTAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054314918 Original CRISPR TCTTATGTAAGATTAACTTA TGG Intergenic
No off target data available for this crispr