ID: 1054318058

View in Genome Browser
Species Human (GRCh38)
Location 9:63619410-63619432
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054318055_1054318058 10 Left 1054318055 9:63619377-63619399 CCATCTTCATAAATTAAAAAAGA No data
Right 1054318058 9:63619410-63619432 CTAGCGAAGTGGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054318058 Original CRISPR CTAGCGAAGTGGAATGAGGA AGG Intergenic
No off target data available for this crispr