ID: 1054318327

View in Genome Browser
Species Human (GRCh38)
Location 9:63623724-63623746
Sequence CTGTTGTTGTTAAGAATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054318327_1054318330 20 Left 1054318327 9:63623724-63623746 CCTTATATTCTTAACAACAACAG No data
Right 1054318330 9:63623767-63623789 TCTTTCTGCCCCATGCACCTAGG No data
1054318327_1054318331 26 Left 1054318327 9:63623724-63623746 CCTTATATTCTTAACAACAACAG No data
Right 1054318331 9:63623773-63623795 TGCCCCATGCACCTAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054318327 Original CRISPR CTGTTGTTGTTAAGAATATA AGG (reversed) Intergenic
No off target data available for this crispr