ID: 1054322509

View in Genome Browser
Species Human (GRCh38)
Location 9:63685400-63685422
Sequence CAGGCACATGGTGTTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054322501_1054322509 24 Left 1054322501 9:63685353-63685375 CCTTCTGGCTGCTTTTGTGGGCT No data
Right 1054322509 9:63685400-63685422 CAGGCACATGGTGTTGTTGGTGG No data
1054322498_1054322509 28 Left 1054322498 9:63685349-63685371 CCTGCCTTCTGGCTGCTTTTGTG No data
Right 1054322509 9:63685400-63685422 CAGGCACATGGTGTTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054322509 Original CRISPR CAGGCACATGGTGTTGTTGG TGG Intergenic
No off target data available for this crispr