ID: 1054324189

View in Genome Browser
Species Human (GRCh38)
Location 9:63704932-63704954
Sequence GAGTTGAATTTGAAGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054324181_1054324189 13 Left 1054324181 9:63704896-63704918 CCACTAGGGGTACCCCAACTCGG No data
Right 1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG No data
1054324177_1054324189 30 Left 1054324177 9:63704879-63704901 CCAGGGTGCGCGTCGGGCCACTA No data
Right 1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG No data
1054324184_1054324189 1 Left 1054324184 9:63704908-63704930 CCCCAACTCGGAGAGAAGGACCA No data
Right 1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG No data
1054324185_1054324189 0 Left 1054324185 9:63704909-63704931 CCCAACTCGGAGAGAAGGACCAT No data
Right 1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG No data
1054324186_1054324189 -1 Left 1054324186 9:63704910-63704932 CCAACTCGGAGAGAAGGACCATG No data
Right 1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054324189 Original CRISPR GAGTTGAATTTGAAGTTTGT GGG Intergenic
No off target data available for this crispr