ID: 1054328498

View in Genome Browser
Species Human (GRCh38)
Location 9:63729856-63729878
Sequence TCCCTGCCCCATGGGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054328498_1054328505 4 Left 1054328498 9:63729856-63729878 CCCAGGGTCCCATGGGGCAGGGA No data
Right 1054328505 9:63729883-63729905 AGGGAAGATGGAGCTCCTCGAGG No data
1054328498_1054328504 -8 Left 1054328498 9:63729856-63729878 CCCAGGGTCCCATGGGGCAGGGA No data
Right 1054328504 9:63729871-63729893 GGCAGGGAAACAAGGGAAGATGG No data
1054328498_1054328506 5 Left 1054328498 9:63729856-63729878 CCCAGGGTCCCATGGGGCAGGGA No data
Right 1054328506 9:63729884-63729906 GGGAAGATGGAGCTCCTCGAGGG No data
1054328498_1054328508 16 Left 1054328498 9:63729856-63729878 CCCAGGGTCCCATGGGGCAGGGA No data
Right 1054328508 9:63729895-63729917 GCTCCTCGAGGGCCTGACAAGGG No data
1054328498_1054328509 17 Left 1054328498 9:63729856-63729878 CCCAGGGTCCCATGGGGCAGGGA No data
Right 1054328509 9:63729896-63729918 CTCCTCGAGGGCCTGACAAGGGG No data
1054328498_1054328507 15 Left 1054328498 9:63729856-63729878 CCCAGGGTCCCATGGGGCAGGGA No data
Right 1054328507 9:63729894-63729916 AGCTCCTCGAGGGCCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054328498 Original CRISPR TCCCTGCCCCATGGGACCCT GGG (reversed) Intergenic