ID: 1054332489

View in Genome Browser
Species Human (GRCh38)
Location 9:63774562-63774584
Sequence CTCTGGACAAGTGCTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054332483_1054332489 4 Left 1054332483 9:63774535-63774557 CCTGAGCTGTGCTGAGGGAGAAA No data
Right 1054332489 9:63774562-63774584 CTCTGGACAAGTGCTGGGAAGGG No data
1054332480_1054332489 11 Left 1054332480 9:63774528-63774550 CCTGAGGCCTGAGCTGTGCTGAG No data
Right 1054332489 9:63774562-63774584 CTCTGGACAAGTGCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054332489 Original CRISPR CTCTGGACAAGTGCTGGGAA GGG Intergenic
No off target data available for this crispr