ID: 1054333409

View in Genome Browser
Species Human (GRCh38)
Location 9:63782002-63782024
Sequence CTGAGGGAGATCGGGGCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054333409_1054333423 7 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333423 9:63782032-63782054 ACTGGGCGGGAGGCACAGCCTGG No data
1054333409_1054333422 -3 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333422 9:63782022-63782044 CAGGTGGAGGACTGGGCGGGAGG No data
1054333409_1054333427 18 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333427 9:63782043-63782065 GGCACAGCCTGGGGGCCCTCAGG No data
1054333409_1054333429 23 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333429 9:63782048-63782070 AGCCTGGGGGCCCTCAGGCTGGG No data
1054333409_1054333428 22 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333428 9:63782047-63782069 CAGCCTGGGGGCCCTCAGGCTGG No data
1054333409_1054333425 9 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333425 9:63782034-63782056 TGGGCGGGAGGCACAGCCTGGGG No data
1054333409_1054333426 10 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333426 9:63782035-63782057 GGGCGGGAGGCACAGCCTGGGGG No data
1054333409_1054333419 -7 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333419 9:63782018-63782040 CCCTCAGGTGGAGGACTGGGCGG No data
1054333409_1054333417 -10 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333417 9:63782015-63782037 TCTCCCTCAGGTGGAGGACTGGG No data
1054333409_1054333421 -6 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333421 9:63782019-63782041 CCTCAGGTGGAGGACTGGGCGGG No data
1054333409_1054333424 8 Left 1054333409 9:63782002-63782024 CCAACGGCCCCGATCTCCCTCAG No data
Right 1054333424 9:63782033-63782055 CTGGGCGGGAGGCACAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054333409 Original CRISPR CTGAGGGAGATCGGGGCCGT TGG (reversed) Intergenic
No off target data available for this crispr