ID: 1054334586

View in Genome Browser
Species Human (GRCh38)
Location 9:63793508-63793530
Sequence ATGTATTTAATGAAGTGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054334584_1054334586 3 Left 1054334584 9:63793482-63793504 CCCTGCTTTAACATTTTGAAAAA No data
Right 1054334586 9:63793508-63793530 ATGTATTTAATGAAGTGATCCGG No data
1054334585_1054334586 2 Left 1054334585 9:63793483-63793505 CCTGCTTTAACATTTTGAAAAAA No data
Right 1054334586 9:63793508-63793530 ATGTATTTAATGAAGTGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054334586 Original CRISPR ATGTATTTAATGAAGTGATC CGG Intergenic
No off target data available for this crispr