ID: 1054349915

View in Genome Browser
Species Human (GRCh38)
Location 9:64012198-64012220
Sequence CCTGATGTCCAGCTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054349915_1054349923 6 Left 1054349915 9:64012198-64012220 CCAGGCCCCAGCTGGACATCAGG No data
Right 1054349923 9:64012227-64012249 GTGGACACCCAGGATCAAGATGG No data
1054349915_1054349927 21 Left 1054349915 9:64012198-64012220 CCAGGCCCCAGCTGGACATCAGG No data
Right 1054349927 9:64012242-64012264 CAAGATGGACATCAGGACTCAGG No data
1054349915_1054349928 24 Left 1054349915 9:64012198-64012220 CCAGGCCCCAGCTGGACATCAGG No data
Right 1054349928 9:64012245-64012267 GATGGACATCAGGACTCAGGTGG No data
1054349915_1054349926 14 Left 1054349915 9:64012198-64012220 CCAGGCCCCAGCTGGACATCAGG No data
Right 1054349926 9:64012235-64012257 CCAGGATCAAGATGGACATCAGG No data
1054349915_1054349921 -4 Left 1054349915 9:64012198-64012220 CCAGGCCCCAGCTGGACATCAGG No data
Right 1054349921 9:64012217-64012239 CAGGCCTAATGTGGACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054349915 Original CRISPR CCTGATGTCCAGCTGGGGCC TGG (reversed) Intergenic
No off target data available for this crispr