ID: 1054350676

View in Genome Browser
Species Human (GRCh38)
Location 9:64015367-64015389
Sequence GGCCCAGCGCAGGGTCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054350662_1054350676 12 Left 1054350662 9:64015332-64015354 CCCTGGGCTCAAACCAGGGATGC No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data
1054350659_1054350676 22 Left 1054350659 9:64015322-64015344 CCGAGGCGCACCCTGGGCTCAAA No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data
1054350670_1054350676 -10 Left 1054350670 9:64015354-64015376 CCAGGGTCCCTGGGGCCCAGCGC No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data
1054350655_1054350676 30 Left 1054350655 9:64015314-64015336 CCAGCGGCCCGAGGCGCACCCTG No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data
1054350663_1054350676 11 Left 1054350663 9:64015333-64015355 CCTGGGCTCAAACCAGGGATGCC No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data
1054350658_1054350676 23 Left 1054350658 9:64015321-64015343 CCCGAGGCGCACCCTGGGCTCAA No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data
1054350667_1054350676 -1 Left 1054350667 9:64015345-64015367 CCAGGGATGCCAGGGTCCCTGGG No data
Right 1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054350676 Original CRISPR GGCCCAGCGCAGGGTCTGAT GGG Intergenic
No off target data available for this crispr