ID: 1054362764

View in Genome Browser
Species Human (GRCh38)
Location 9:64193156-64193178
Sequence CAGGATAAACACTAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054362759_1054362764 1 Left 1054362759 9:64193132-64193154 CCAATGGCAAAAAAGCTAATATC No data
Right 1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054362764 Original CRISPR CAGGATAAACACTAGAAGGA AGG Intergenic
No off target data available for this crispr