ID: 1054378027

View in Genome Browser
Species Human (GRCh38)
Location 9:64463230-64463252
Sequence AGAGACTGTCCCTGCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054378021_1054378027 21 Left 1054378021 9:64463186-64463208 CCTTAGAGTGACATGGATCAGTC 0: 4
1: 2
2: 3
3: 8
4: 94
Right 1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG No data
1054378025_1054378027 -7 Left 1054378025 9:64463214-64463236 CCTGAAGGTAAATGGAAGAGACT 0: 4
1: 0
2: 4
3: 35
4: 199
Right 1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG No data
1054378019_1054378027 30 Left 1054378019 9:64463177-64463199 CCTTGGTTGCCTTAGAGTGACAT 0: 4
1: 2
2: 12
3: 14
4: 142
Right 1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG No data
1054378024_1054378027 -6 Left 1054378024 9:64463213-64463235 CCCTGAAGGTAAATGGAAGAGAC 0: 4
1: 0
2: 4
3: 24
4: 244
Right 1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054378027 Original CRISPR AGAGACTGTCCCTGCTGTGT GGG Intergenic
No off target data available for this crispr