ID: 1054379677

View in Genome Browser
Species Human (GRCh38)
Location 9:64476442-64476464
Sequence ACAGCTTGTGGGCTGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054379677_1054379683 -6 Left 1054379677 9:64476442-64476464 CCTGCATTCAGCCCACAAGCTGT No data
Right 1054379683 9:64476459-64476481 AGCTGTGGGTTGGACAAGCTTGG 0: 4
1: 29
2: 69
3: 134
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054379677 Original CRISPR ACAGCTTGTGGGCTGAATGC AGG (reversed) Intergenic
No off target data available for this crispr