ID: 1054380412

View in Genome Browser
Species Human (GRCh38)
Location 9:64485165-64485187
Sequence GTCTGTCAACCCAACACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054380409_1054380412 7 Left 1054380409 9:64485135-64485157 CCTACTGAGGGGCTGGGCGCGGT No data
Right 1054380412 9:64485165-64485187 GTCTGTCAACCCAACACTTTGGG No data
1054380405_1054380412 15 Left 1054380405 9:64485127-64485149 CCTTAAGACCTACTGAGGGGCTG No data
Right 1054380412 9:64485165-64485187 GTCTGTCAACCCAACACTTTGGG No data
1054380401_1054380412 23 Left 1054380401 9:64485119-64485141 CCGGGGCTCCTTAAGACCTACTG No data
Right 1054380412 9:64485165-64485187 GTCTGTCAACCCAACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054380412 Original CRISPR GTCTGTCAACCCAACACTTT GGG Intergenic
No off target data available for this crispr