ID: 1054388314

View in Genome Browser
Species Human (GRCh38)
Location 9:64585098-64585120
Sequence TCATTTCCACACAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054388314_1054388315 13 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388315 9:64585134-64585156 GTCAGTTAATGTGTTTTCAATGG No data
1054388314_1054388316 18 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388316 9:64585139-64585161 TTAATGTGTTTTCAATGGTGAGG No data
1054388314_1054388318 20 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388318 9:64585141-64585163 AATGTGTTTTCAATGGTGAGGGG No data
1054388314_1054388317 19 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388317 9:64585140-64585162 TAATGTGTTTTCAATGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054388314 Original CRISPR TCATTTCCACACAAAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr