ID: 1054388315

View in Genome Browser
Species Human (GRCh38)
Location 9:64585134-64585156
Sequence GTCAGTTAATGTGTTTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054388314_1054388315 13 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388315 9:64585134-64585156 GTCAGTTAATGTGTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054388315 Original CRISPR GTCAGTTAATGTGTTTTCAA TGG Intergenic
No off target data available for this crispr