ID: 1054388316

View in Genome Browser
Species Human (GRCh38)
Location 9:64585139-64585161
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054388314_1054388316 18 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388316 9:64585139-64585161 TTAATGTGTTTTCAATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054388316 Original CRISPR TTAATGTGTTTTCAATGGTG AGG Intergenic
No off target data available for this crispr