ID: 1054388317

View in Genome Browser
Species Human (GRCh38)
Location 9:64585140-64585162
Sequence TAATGTGTTTTCAATGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054388314_1054388317 19 Left 1054388314 9:64585098-64585120 CCATCTTCTTTGTGTGGAAATGA No data
Right 1054388317 9:64585140-64585162 TAATGTGTTTTCAATGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054388317 Original CRISPR TAATGTGTTTTCAATGGTGA GGG Intergenic
No off target data available for this crispr