ID: 1054389879

View in Genome Browser
Species Human (GRCh38)
Location 9:64605297-64605319
Sequence GGCACTGATGTGATGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054389879_1054389887 11 Left 1054389879 9:64605297-64605319 CCTGCTGGCATCACATCAGTGCC No data
Right 1054389887 9:64605331-64605353 GAGTTCAAAAAAGAAGGAGCAGG No data
1054389879_1054389886 5 Left 1054389879 9:64605297-64605319 CCTGCTGGCATCACATCAGTGCC No data
Right 1054389886 9:64605325-64605347 GGGATGGAGTTCAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054389879 Original CRISPR GGCACTGATGTGATGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr