ID: 1054402188

View in Genome Browser
Species Human (GRCh38)
Location 9:64719526-64719548
Sequence GATTTGCCCTGCCCCAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054402185_1054402188 7 Left 1054402185 9:64719496-64719518 CCAGAGCTGGACTTGGAGGTGTC No data
Right 1054402188 9:64719526-64719548 GATTTGCCCTGCCCCAACGTTGG No data
1054402180_1054402188 24 Left 1054402180 9:64719479-64719501 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1054402188 9:64719526-64719548 GATTTGCCCTGCCCCAACGTTGG No data
1054402182_1054402188 18 Left 1054402182 9:64719485-64719507 CCAAGGCAGGGCCAGAGCTGGAC No data
Right 1054402188 9:64719526-64719548 GATTTGCCCTGCCCCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054402188 Original CRISPR GATTTGCCCTGCCCCAACGT TGG Intergenic
No off target data available for this crispr