ID: 1054405940

View in Genome Browser
Species Human (GRCh38)
Location 9:64762743-64762765
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054405936_1054405940 15 Left 1054405936 9:64762705-64762727 CCCAGTATAGGACAAGAGCTGTC No data
Right 1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG No data
1054405937_1054405940 14 Left 1054405937 9:64762706-64762728 CCAGTATAGGACAAGAGCTGTCT No data
Right 1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG No data
1054405935_1054405940 24 Left 1054405935 9:64762696-64762718 CCACAAAAGCCCAGTATAGGACA No data
Right 1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054405940 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr