ID: 1054415808

View in Genome Browser
Species Human (GRCh38)
Location 9:64874740-64874762
Sequence CTCAACCATCTGCAGTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054415808_1054415812 29 Left 1054415808 9:64874740-64874762 CCCTCGAACTGCAGATGGTTGAG No data
Right 1054415812 9:64874792-64874814 CTATATCTTCACCAGCGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054415808 Original CRISPR CTCAACCATCTGCAGTTCGA GGG (reversed) Intergenic
No off target data available for this crispr