ID: 1054417361

View in Genome Browser
Species Human (GRCh38)
Location 9:64889845-64889867
Sequence GGCGCGAGCCAAGGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054417361_1054417367 2 Left 1054417361 9:64889845-64889867 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1054417367 9:64889870-64889892 GAGTGCTGGTTTGCAGGCTCTGG No data
1054417361_1054417369 4 Left 1054417361 9:64889845-64889867 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1054417369 9:64889872-64889894 GTGCTGGTTTGCAGGCTCTGGGG No data
1054417361_1054417364 -4 Left 1054417361 9:64889845-64889867 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1054417364 9:64889864-64889886 CGCCCTGAGTGCTGGTTTGCAGG No data
1054417361_1054417371 25 Left 1054417361 9:64889845-64889867 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1054417371 9:64889893-64889915 GGACTGTGCAGTCGCCAGGATGG No data
1054417361_1054417370 21 Left 1054417361 9:64889845-64889867 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1054417370 9:64889889-64889911 CTGGGGACTGTGCAGTCGCCAGG No data
1054417361_1054417368 3 Left 1054417361 9:64889845-64889867 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1054417368 9:64889871-64889893 AGTGCTGGTTTGCAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054417361 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr